ID: 1078479021

View in Genome Browser
Species Human (GRCh38)
Location 11:11660035-11660057
Sequence AGACTGGGGTTTCTCAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078479010_1078479021 29 Left 1078479010 11:11659983-11660005 CCTCCCTAATAGGGATGGGCCTC No data
Right 1078479021 11:11660035-11660057 AGACTGGGGTTTCTCAAAGAAGG No data
1078479012_1078479021 25 Left 1078479012 11:11659987-11660009 CCTAATAGGGATGGGCCTCATCC No data
Right 1078479021 11:11660035-11660057 AGACTGGGGTTTCTCAAAGAAGG No data
1078479011_1078479021 26 Left 1078479011 11:11659986-11660008 CCCTAATAGGGATGGGCCTCATC No data
Right 1078479021 11:11660035-11660057 AGACTGGGGTTTCTCAAAGAAGG No data
1078479009_1078479021 30 Left 1078479009 11:11659982-11660004 CCCTCCCTAATAGGGATGGGCCT No data
Right 1078479021 11:11660035-11660057 AGACTGGGGTTTCTCAAAGAAGG No data
1078479016_1078479021 4 Left 1078479016 11:11660008-11660030 CCAATCAGGTGAAGGCCTAAACA No data
Right 1078479021 11:11660035-11660057 AGACTGGGGTTTCTCAAAGAAGG No data
1078479015_1078479021 10 Left 1078479015 11:11660002-11660024 CCTCATCCAATCAGGTGAAGGCC 0: 13
1: 213
2: 548
3: 835
4: 991
Right 1078479021 11:11660035-11660057 AGACTGGGGTTTCTCAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078479021 Original CRISPR AGACTGGGGTTTCTCAAAGA AGG Intergenic
No off target data available for this crispr