ID: 1078480249

View in Genome Browser
Species Human (GRCh38)
Location 11:11669152-11669174
Sequence CCCTAGGGATGCCTCTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078480240_1078480249 23 Left 1078480240 11:11669106-11669128 CCTTGGGTGCATTCAGGCTGTTG No data
Right 1078480249 11:11669152-11669174 CCCTAGGGATGCCTCTGTCCAGG No data
1078480244_1078480249 0 Left 1078480244 11:11669129-11669151 CCAGGAAGACGGGTCTTCTGAGC No data
Right 1078480249 11:11669152-11669174 CCCTAGGGATGCCTCTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078480249 Original CRISPR CCCTAGGGATGCCTCTGTCC AGG Intergenic
No off target data available for this crispr