ID: 1078480394

View in Genome Browser
Species Human (GRCh38)
Location 11:11670640-11670662
Sequence CTGGAGATCTTAAAGTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078480394_1078480398 1 Left 1078480394 11:11670640-11670662 CCAGGACACTTTAAGATCTCCAG No data
Right 1078480398 11:11670664-11670686 GAGATCAACAACAATATCAGAGG No data
1078480394_1078480399 18 Left 1078480394 11:11670640-11670662 CCAGGACACTTTAAGATCTCCAG No data
Right 1078480399 11:11670681-11670703 CAGAGGCTTCGACTCTAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078480394 Original CRISPR CTGGAGATCTTAAAGTGTCC TGG (reversed) Intergenic
No off target data available for this crispr