ID: 1078480635

View in Genome Browser
Species Human (GRCh38)
Location 11:11672366-11672388
Sequence TTGAGCAAGGCGGAGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078480635_1078480641 9 Left 1078480635 11:11672366-11672388 CCATGCACCTCCGCCTTGCTCAA No data
Right 1078480641 11:11672398-11672420 CTTAGCTCTCACTTCACCAGAGG No data
1078480635_1078480643 21 Left 1078480635 11:11672366-11672388 CCATGCACCTCCGCCTTGCTCAA No data
Right 1078480643 11:11672410-11672432 TTCACCAGAGGAAGGACTGCAGG No data
1078480635_1078480642 13 Left 1078480635 11:11672366-11672388 CCATGCACCTCCGCCTTGCTCAA No data
Right 1078480642 11:11672402-11672424 GCTCTCACTTCACCAGAGGAAGG No data
1078480635_1078480644 22 Left 1078480635 11:11672366-11672388 CCATGCACCTCCGCCTTGCTCAA No data
Right 1078480644 11:11672411-11672433 TCACCAGAGGAAGGACTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078480635 Original CRISPR TTGAGCAAGGCGGAGGTGCA TGG (reversed) Intergenic
No off target data available for this crispr