ID: 1078480947

View in Genome Browser
Species Human (GRCh38)
Location 11:11674857-11674879
Sequence AAGTTTTTAAAAGTGCTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078480947_1078480949 0 Left 1078480947 11:11674857-11674879 CCTTGTAGCACTTTTAAAAACTT No data
Right 1078480949 11:11674880-11674902 GGCCTCACTTCAATTCCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078480947 Original CRISPR AAGTTTTTAAAAGTGCTACA AGG (reversed) Intergenic
No off target data available for this crispr