ID: 1078486143

View in Genome Browser
Species Human (GRCh38)
Location 11:11725178-11725200
Sequence CGTCATCCCCAGAAGGTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078486139_1078486143 18 Left 1078486139 11:11725137-11725159 CCAGGTGAGCTGGAGCTTTGTCT No data
Right 1078486143 11:11725178-11725200 CGTCATCCCCAGAAGGTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078486143 Original CRISPR CGTCATCCCCAGAAGGTACC AGG Intergenic
No off target data available for this crispr