ID: 1078490177

View in Genome Browser
Species Human (GRCh38)
Location 11:11761016-11761038
Sequence CTGTCTTGGAAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078490177_1078490182 -10 Left 1078490177 11:11761016-11761038 CCTTCCTCCTTCTTCCAAGACAG No data
Right 1078490182 11:11761029-11761051 TCCAAGACAGCACTTGAGGGTGG No data
1078490177_1078490184 22 Left 1078490177 11:11761016-11761038 CCTTCCTCCTTCTTCCAAGACAG No data
Right 1078490184 11:11761061-11761083 TATTTGTACAGTAGTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078490177 Original CRISPR CTGTCTTGGAAGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr