ID: 1078490423

View in Genome Browser
Species Human (GRCh38)
Location 11:11762959-11762981
Sequence CCAATTACCCAGTAGAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078490423_1078490426 -5 Left 1078490423 11:11762959-11762981 CCTGGGCTCTACTGGGTAATTGG No data
Right 1078490426 11:11762977-11762999 ATTGGCATGTCAGGAGACACTGG No data
1078490423_1078490427 -4 Left 1078490423 11:11762959-11762981 CCTGGGCTCTACTGGGTAATTGG No data
Right 1078490427 11:11762978-11763000 TTGGCATGTCAGGAGACACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078490423 Original CRISPR CCAATTACCCAGTAGAGCCC AGG (reversed) Intergenic
No off target data available for this crispr