ID: 1078490571

View in Genome Browser
Species Human (GRCh38)
Location 11:11764212-11764234
Sequence TAAGCTTCACACTCAGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078490566_1078490571 4 Left 1078490566 11:11764185-11764207 CCCATAGATCCTCATATTCTCCC No data
Right 1078490571 11:11764212-11764234 TAAGCTTCACACTCAGAGCCTGG No data
1078490567_1078490571 3 Left 1078490567 11:11764186-11764208 CCATAGATCCTCATATTCTCCCT No data
Right 1078490571 11:11764212-11764234 TAAGCTTCACACTCAGAGCCTGG No data
1078490568_1078490571 -5 Left 1078490568 11:11764194-11764216 CCTCATATTCTCCCTCTCTAAGC No data
Right 1078490571 11:11764212-11764234 TAAGCTTCACACTCAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078490571 Original CRISPR TAAGCTTCACACTCAGAGCC TGG Intergenic
No off target data available for this crispr