ID: 1078493193

View in Genome Browser
Species Human (GRCh38)
Location 11:11788418-11788440
Sequence CTGGCTAATTGCTGTCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078493193_1078493195 6 Left 1078493193 11:11788418-11788440 CCTTCATGACAGCAATTAGCCAG No data
Right 1078493195 11:11788447-11788469 TGCTCCCTTCAGCCTGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078493193 Original CRISPR CTGGCTAATTGCTGTCATGA AGG (reversed) Intergenic
No off target data available for this crispr