ID: 1078498693

View in Genome Browser
Species Human (GRCh38)
Location 11:11846829-11846851
Sequence CAATTGCAGCACATTTCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078498693_1078498694 12 Left 1078498693 11:11846829-11846851 CCTGAGGAAATGTGCTGCAATTG 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1078498694 11:11846864-11846886 TTAGTGATTCTTTTAAAATGAGG 0: 1
1: 0
2: 5
3: 80
4: 583

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078498693 Original CRISPR CAATTGCAGCACATTTCCTC AGG (reversed) Intronic
900439542 1:2646808-2646830 CAATTTCACCACCTTCCCTCAGG + Intronic
900843253 1:5073993-5074015 AAATTGAAGCACATTTTCCCTGG + Intergenic
903529808 1:24021556-24021578 CATTTGAAGCTCATTCCCTCAGG - Intergenic
904865611 1:33576720-33576742 ACATTTCAGCACATTTCCTTTGG - Intronic
905002207 1:34681479-34681501 GAATTGCTTCACATTTCCTTAGG - Intergenic
906946530 1:50299380-50299402 CAATTGCAGTTCCATTCCTCAGG - Intergenic
908002743 1:59696684-59696706 CACTTGCTGCACTTTTCCTGGGG - Intronic
909876362 1:80809433-80809455 CAACAGCAGCCCAGTTCCTCAGG + Intergenic
910070149 1:83204086-83204108 CAGTGGCATCACATTACCTCTGG - Intergenic
910590092 1:88920922-88920944 GCATTGCAGGACTTTTCCTCAGG + Intergenic
911273871 1:95837829-95837851 CAATTGGCTCACAGTTCCTCAGG + Intergenic
918102425 1:181387884-181387906 CTATTGCAACACATTTCCCTAGG + Intergenic
919505137 1:198388843-198388865 CTATTGCAGCACATCTATTCTGG + Intergenic
921593684 1:217031888-217031910 TAATTGAATCACATTTCCACAGG - Intronic
921616002 1:217268517-217268539 CAATTGTAGCCCATTTCCTGTGG - Intergenic
923880288 1:238096427-238096449 GAATTGCATCACAATTCTTCAGG + Intergenic
1064694859 10:17954962-17954984 CTATTATAACACATTTCCTCTGG - Intronic
1070023407 10:72608602-72608624 CAATTTCTCCACATTTTCTCTGG - Intronic
1071038027 10:81270633-81270655 TAATTGACGCACATTTCCACAGG - Intergenic
1072950948 10:99846323-99846345 CCACTGCAGCCCAGTTCCTCTGG + Intronic
1074810702 10:117102446-117102468 CACTGGCAGCCCATTTCCTCAGG - Intronic
1078498693 11:11846829-11846851 CAATTGCAGCACATTTCCTCAGG - Intronic
1080301669 11:30791455-30791477 CATTTGGAGAGCATTTCCTCTGG + Intergenic
1080434243 11:32224970-32224992 CCATTGAAGCAGATTTCCTTAGG - Intergenic
1081275382 11:41141753-41141775 CAATTGACTCACATTTCCTCAGG - Intronic
1084277543 11:68062007-68062029 CCCTTGCATCTCATTTCCTCTGG - Exonic
1086527936 11:87750960-87750982 CAATTGCATCCCATTTACCCAGG + Intergenic
1088519173 11:110676350-110676372 TAATTGCCTCACAGTTCCTCAGG + Intronic
1088700621 11:112408096-112408118 CATTTGCAGCTCAGTACCTCTGG + Intergenic
1088929859 11:114340745-114340767 CCAGAGCCGCACATTTCCTCAGG + Intergenic
1089427618 11:118392874-118392896 CCATTGCAAGACATTTGCTCAGG + Exonic
1090634516 11:128682393-128682415 CAATTTCAGCAATTTTCTTCCGG + Intergenic
1091654477 12:2335492-2335514 GAATGGCAGCACCTTTCCACGGG + Intronic
1096047925 12:48580703-48580725 GAATGGCAGCCCATTTCCACAGG - Intergenic
1099403068 12:82224055-82224077 CATTTTCAGCACATTTCATTAGG + Intronic
1099908098 12:88795845-88795867 CAATCGCATAACATTTGCTCAGG + Intergenic
1104525240 12:129514846-129514868 AAATTGCAGCACTGTTCCTATGG + Intronic
1111531824 13:89546627-89546649 CAAATACAGCACATTTCTTTTGG + Intergenic
1111775022 13:92650389-92650411 CATTTGCAGCCCATTTGCTCTGG - Intronic
1111815456 13:93147427-93147449 CAAGTGCAGCACTTTTCCCAAGG - Intergenic
1114585167 14:23805011-23805033 CAGCTGCAGCTCATTTACTCAGG + Intergenic
1115572163 14:34676913-34676935 CAGTTGCAGCAAAGTTCTTCTGG + Intergenic
1115902379 14:38166642-38166664 CCATAGCATCACATTTCCTTAGG - Intergenic
1117336709 14:54762278-54762300 CAATGCCAGCACTTTTCCTTTGG + Intronic
1117946179 14:61024399-61024421 CCTCTGCAGCCCATTTCCTCAGG + Intronic
1125121712 15:36167577-36167599 CAATTTAAGAACATTTCCTTTGG + Intergenic
1125298219 15:38225646-38225668 AAATTGCATCACAATTCTTCAGG + Intergenic
1125426314 15:39553066-39553088 CAATTGCAGCAGAATTCCAAAGG - Intergenic
1126691655 15:51293486-51293508 GAATTAAAGCACATTTTCTCTGG - Intronic
1126779456 15:52126275-52126297 CAAATACAGCAAATTTCTTCAGG + Intronic
1127051195 15:55085778-55085800 GAAATCCAGAACATTTCCTCAGG + Intergenic
1128188952 15:65672074-65672096 GAATTAGAGCACATTTCCTTAGG - Intronic
1130874285 15:87998947-87998969 CCATTGCAGTACATCACCTCTGG - Intronic
1132310413 15:100853627-100853649 CAATTGCTGCAGATTTGCTGGGG - Intergenic
1133907064 16:10031979-10032001 CAGTTTCAGCCCATGTCCTCAGG + Intronic
1135427212 16:22348631-22348653 AAATACCAACACATTTCCTCAGG - Intronic
1137888185 16:52128958-52128980 CAATGGCTGCCCATTTTCTCTGG - Intergenic
1143236695 17:5408036-5408058 TAATTCCAGCAAATTTTCTCGGG + Intronic
1144536884 17:16098483-16098505 CAATTGCAGAATGTTTCCTATGG - Exonic
1144720677 17:17467752-17467774 CAATTCCCGCTCACTTCCTCAGG - Intergenic
1151529493 17:74695450-74695472 CCAGTGCAGCACATTTCCTGTGG + Intronic
1153527639 18:6012988-6013010 CCATCGCAGCACAGTTCCTCAGG + Intronic
1158664763 18:59422511-59422533 CAATTGCAACAAGTTTCCTCAGG + Intergenic
1160166602 18:76518444-76518466 CAATAGTACCACATTTTCTCTGG + Intergenic
1163056200 19:14720237-14720259 CAAGGGCAGGCCATTTCCTCCGG + Exonic
1166161461 19:40956728-40956750 CAATTGCTGCACATTTGTACAGG - Intergenic
925218436 2:2117318-2117340 CTACTGCAACACATTTTCTCTGG - Intronic
927246531 2:20961121-20961143 CAATTGATTCACAGTTCCTCAGG - Intergenic
927465554 2:23333852-23333874 TAATTATAGCACCTTTCCTCTGG - Intergenic
928336619 2:30404127-30404149 CGATTCCATCACTTTTCCTCTGG + Intergenic
930331143 2:49985950-49985972 CAAATGAAGTACATTTCCTTGGG - Intronic
933968082 2:87446772-87446794 AAATTGCAGCGCGTTTTCTCTGG - Intergenic
935040478 2:99421508-99421530 CAGAGGCAGCACATTTCGTCTGG + Exonic
936325714 2:111503741-111503763 AAATTGCAGCGCGTTTTCTCTGG + Intergenic
936978310 2:118240890-118240912 CAAAAGCAGCAGAGTTCCTCTGG - Intergenic
938015736 2:127865591-127865613 CAAATGTATCACATTTACTCTGG - Intronic
939036632 2:137139483-137139505 ACATTGCAGCATATTACCTCGGG - Intronic
939328995 2:140734257-140734279 CAATTTCTGCATATTTCCTAGGG - Intronic
939404353 2:141736746-141736768 CATTTGCATCACCTTTTCTCAGG + Intronic
939488943 2:142853522-142853544 GAATTGCAGTACATTTCTTCAGG + Intergenic
941012162 2:160312872-160312894 AAATAGCAGCATATTTTCTCAGG - Intronic
942239480 2:173946493-173946515 CATTTCCAACTCATTTCCTCAGG + Intronic
942339492 2:174928740-174928762 TACATGCAGCACATTTTCTCAGG - Intronic
943806111 2:192128992-192129014 CAGTAGCCACACATTTCCTCTGG + Intronic
947334287 2:229065820-229065842 CTATTGCAACACATTTCCAAAGG + Intronic
948225816 2:236308592-236308614 CAAATGCTGCACATTCCTTCTGG - Intergenic
948807139 2:240457875-240457897 GAATTCCAGCAACTTTCCTCAGG - Intronic
1170071577 20:12374867-12374889 CAAATGCACCACATATTCTCTGG - Intergenic
1171061777 20:21971413-21971435 GAACTGGAGCCCATTTCCTCTGG + Intergenic
1176986620 21:15444882-15444904 CGATTACAGGACATTTCTTCTGG + Intergenic
1180944975 22:19687875-19687897 GAATTGCAGCACAGCTCCGCAGG + Intergenic
1185396829 22:50596240-50596262 TAATTGAAGCACATTTCTTATGG + Intronic
949901424 3:8817970-8817992 CAAATGCAACACATTTAGTCAGG - Intronic
953822791 3:46222630-46222652 CAATGGCAGCACCTTGCCACAGG + Intronic
955425576 3:58786099-58786121 CATTTGCAGCACACATCCTGTGG - Intronic
957137899 3:76312536-76312558 AATTTGCAGCACCATTCCTCTGG - Intronic
957909397 3:86602778-86602800 CAATTGACTCACAGTTCCTCAGG - Intergenic
958472862 3:94543333-94543355 CAAATGGAGGACATTGCCTCAGG - Intergenic
960721107 3:120625328-120625350 CACTTGGAGCAGAATTCCTCTGG + Intergenic
964556424 3:157944491-157944513 CAATTTAAGGACATTTCCTCTGG + Intergenic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
970595756 4:17598688-17598710 CAACTGCAGAACAATTCCTCTGG - Intronic
971659475 4:29393445-29393467 CAATTACTGCCCAATTCCTCTGG - Intergenic
975125460 4:70777536-70777558 CAATTTAAGTACATTTTCTCTGG + Intronic
975201900 4:71600758-71600780 AAATTGTAACACATTTCCCCAGG - Intergenic
978359328 4:107911648-107911670 CAATTGCGGCATATGTCCTTAGG - Exonic
978464070 4:108988806-108988828 CACTGGCAACACTTTTCCTCTGG + Intronic
979172656 4:117621883-117621905 CAATTACAGCCCTTGTCCTCTGG + Intergenic
991601661 5:68356998-68357020 CAGTTGCAGGATATTTACTCCGG + Intergenic
998486699 5:142509224-142509246 AAATTGCATCACATTTATTCAGG + Intergenic
999609356 5:153352471-153352493 CAACTATAGCACATTTCTTCTGG + Intergenic
1000392604 5:160740707-160740729 CATTGGCACCACCTTTCCTCAGG + Intronic
1000912126 5:167035178-167035200 TAATTGCAGCATATTTCATTAGG + Intergenic
1001234031 5:170014508-170014530 CACTTGCAGCACATTTCTAATGG + Intronic
1002761613 6:206785-206807 CTATTTCAGCATACTTCCTCTGG + Intergenic
1003236163 6:4296834-4296856 CAATGGCAGCACAGTTGGTCAGG + Intergenic
1006219126 6:32473151-32473173 CCTTTGCATCACATGTCCTCAGG - Intergenic
1006231300 6:32589378-32589400 CCTTTGCATCACATGTCCTCAGG - Intronic
1006940522 6:37749019-37749041 CAATTGGGGCTCAGTTCCTCTGG - Intergenic
1009159792 6:60267938-60267960 AAGTTGCACCAGATTTCCTCAGG - Intergenic
1010258946 6:73793311-73793333 CACTAGCATGACATTTCCTCAGG - Intronic
1011573365 6:88764742-88764764 AAATTGGAGCATATTTTCTCAGG + Intronic
1012357372 6:98332278-98332300 CAATCCCAGGACCTTTCCTCTGG + Intergenic
1016043467 6:139456768-139456790 CCATTGCTCCACACTTCCTCCGG - Intergenic
1018548997 6:164971956-164971978 CAAATGGAGCCCATTTCTTCTGG - Intergenic
1020546510 7:9540009-9540031 CAATTGAAACACAGTTCCTCAGG - Intergenic
1021682420 7:23147508-23147530 AAATAGCAGCACTGTTCCTCAGG - Intronic
1022208454 7:28185229-28185251 CTATTGCAGTCCGTTTCCTCTGG + Intergenic
1023485870 7:40686102-40686124 CAACTGTACCACATTTACTCAGG - Intronic
1023525850 7:41102077-41102099 CAATTCCAGGCCCTTTCCTCTGG - Intergenic
1024909990 7:54436488-54436510 CACTTCCATCACATTTCATCAGG + Intergenic
1027287921 7:76669260-76669282 CAGTGGCATCACATTACCTCTGG - Intergenic
1032027126 7:128452479-128452501 CAATTCAAACATATTTCCTCTGG - Intergenic
1032622844 7:133555114-133555136 CAAGTGCAGCACAGTCCCTTAGG - Intronic
1032954662 7:136956867-136956889 CTATTGCATTACACTTCCTCTGG - Intronic
1033119083 7:138651072-138651094 CAATTTTGGCACATTCCCTCAGG + Intronic
1033249249 7:139744846-139744868 CAACTGCAGAACGGTTCCTCTGG + Intronic
1039117987 8:34113610-34113632 CAATTGTAGCCTACTTCCTCTGG + Intergenic
1041148835 8:54910775-54910797 CTTTTGAAGCTCATTTCCTCAGG + Intergenic
1041470481 8:58203172-58203194 CAATGGCCCCCCATTTCCTCAGG + Intronic
1042489237 8:69379910-69379932 CAATTGCGTCAGGTTTCCTCAGG - Intergenic
1042938281 8:74082290-74082312 CAATTGCACCATTTTTCTTCTGG + Intergenic
1043916931 8:85933761-85933783 CATTTGCTGCACACTTCTTCAGG + Intergenic
1045839965 8:106568043-106568065 AAATGGAAACACATTTCCTCAGG + Intronic
1046126119 8:109910516-109910538 ACACTGCAGCTCATTTCCTCTGG - Intergenic
1046556430 8:115779149-115779171 CAATTAGTACACATTTCCTCAGG + Intronic
1048338674 8:133522424-133522446 GAATTGCAACACATTTCCAGAGG - Intronic
1048830581 8:138472921-138472943 CAAATGGAGCACATTTTATCTGG + Intronic
1051650279 9:19316663-19316685 CAATTGAAGCAGATTTCTCCTGG + Exonic
1060210607 9:121707910-121707932 CAACTTCACCACATTTCGTCAGG + Intronic
1060945282 9:127566835-127566857 CAAAGGCAGCTCACTTCCTCTGG + Intronic
1189357746 X:40324267-40324289 CAGTTGGAGCTCATTTCCACAGG - Intergenic
1192309876 X:70001973-70001995 CAATTGCATCAGAATTCCTAGGG + Intronic
1193832644 X:86307754-86307776 CAAGTGTAGCACACCTCCTCAGG - Intronic
1193890468 X:87039303-87039325 CAATTGGAGCTTAATTCCTCTGG + Intergenic
1196153052 X:112395285-112395307 CAAGTGCAGCAAATTTTATCAGG - Intergenic
1197529095 X:127600843-127600865 TAATTGAATCACAGTTCCTCAGG + Intergenic
1198990869 X:142513996-142514018 TAATTGACGCACATTTCCACAGG + Intergenic
1199385248 X:147215979-147216001 CAATGTTAACACATTTCCTCAGG - Intergenic
1199855951 X:151758959-151758981 CAAGTCCAGCACCTTTGCTCAGG - Intergenic
1199875752 X:151926620-151926642 GAACTACAGCGCATTTCCTCTGG + Intergenic
1199893645 X:152112561-152112583 GAATTAAAGCACATTTCCCCTGG - Intergenic
1199950725 X:152703822-152703844 GAATTACAGCACATTTCCCCGGG + Intergenic
1199953050 X:152720411-152720433 GAATTACAGCACATTTCCCCGGG + Intergenic
1199956633 X:152748035-152748057 GAATTACAGCACATTTCCCCGGG - Intergenic
1199958957 X:152764639-152764661 GAATTACAGCACATTTCCCCGGG - Intergenic
1201436418 Y:13963766-13963788 CTATTGCTGCACAGTACCTCAGG + Intergenic