ID: 1078500341

View in Genome Browser
Species Human (GRCh38)
Location 11:11867944-11867966
Sequence GCATGTGGTTGCACGTTCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078500338_1078500341 19 Left 1078500338 11:11867902-11867924 CCAGGTGGTGTGAATTGGGGCTG 0: 1
1: 0
2: 1
3: 30
4: 176
Right 1078500341 11:11867944-11867966 GCATGTGGTTGCACGTTCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 115
1078500336_1078500341 22 Left 1078500336 11:11867899-11867921 CCACCAGGTGGTGTGAATTGGGG 0: 1
1: 0
2: 0
3: 8
4: 142
Right 1078500341 11:11867944-11867966 GCATGTGGTTGCACGTTCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078500341 Original CRISPR GCATGTGGTTGCACGTTCTT AGG Intronic
904606751 1:31702149-31702171 GCCTGTGGCTGCTCGGTCTTTGG - Exonic
908089786 1:60673892-60673914 GCCTGTGGTTTCACCTACTTGGG - Intergenic
908146600 1:61252742-61252764 GCATGTGTATGTACATTCTTTGG - Intronic
912393154 1:109318775-109318797 GCATGTGGTTCCAGCTCCTTGGG - Intronic
912953600 1:114137239-114137261 GCTTCTGGTTGCATGTTCTGGGG - Intronic
913495136 1:119421747-119421769 GCATGTGGTTGCAGCTCCTTTGG + Intronic
918284561 1:183039323-183039345 TCATGTGATTGCCCCTTCTTGGG + Intronic
921069457 1:211646959-211646981 GCCTGTGGTTGCAGGTACTTGGG - Intergenic
1063002269 10:1935703-1935725 GCATGTGTGTGTACGTTCTGGGG + Intergenic
1065783619 10:29193017-29193039 GCTTGTGGTCCCACCTTCTTGGG + Intergenic
1068178131 10:53487796-53487818 GCCTGTGGTTTCAGGTTTTTTGG + Intergenic
1070747392 10:78942544-78942566 GCATGTGCTTGCATGTTTTAGGG - Intergenic
1073754139 10:106562922-106562944 GCATGTAGTTTCAGGTACTTGGG - Intergenic
1075269756 10:121038444-121038466 GCATGTGTGTGCATGTGCTTTGG - Intergenic
1076859183 10:133132481-133132503 GCATGTGTGTGCATGCTCTTTGG + Intergenic
1077580759 11:3415788-3415810 GCCTGTAGTTGCACCTACTTGGG - Intergenic
1078178620 11:8990431-8990453 GCATGTGTTTGAACCTTTTTTGG - Intronic
1078500341 11:11867944-11867966 GCATGTGGTTGCACGTTCTTAGG + Intronic
1078811396 11:14769814-14769836 GCAAGTGGTAGCTGGTTCTTGGG - Intronic
1079464803 11:20719609-20719631 GCTTATGGTTTCACTTTCTTGGG + Intronic
1083211340 11:61189006-61189028 GCCTGTAGTTCCAGGTTCTTGGG - Intergenic
1086440458 11:86824181-86824203 GCCTGTGGTTCCACCTACTTGGG + Intronic
1088560971 11:111116012-111116034 GCATGTGGTTGGATGAGCTTGGG - Intergenic
1089507607 11:118974327-118974349 GCCTGTGGTTGCAGCTACTTTGG - Intronic
1092996414 12:13954996-13955018 TCATGTGGTTGCCCTTTTTTAGG + Intronic
1093046796 12:14455707-14455729 GCCTGTGGTCCCACCTTCTTGGG - Intronic
1098151233 12:67548669-67548691 GCCTGTGGTTCCAGGTACTTGGG + Intergenic
1101709481 12:107251516-107251538 ACATCAGGCTGCACGTTCTTCGG - Intergenic
1103861458 12:124017984-124018006 GCATATGGTTACTCGTTGTTTGG + Intronic
1105544017 13:21338892-21338914 GCATGTGGTTGGATGTCCTCAGG + Intergenic
1109831229 13:67791478-67791500 GCCTGTAGTTCCACGTACTTGGG + Intergenic
1112254506 13:97817324-97817346 GCCTGTGGTTGCAGCTACTTGGG + Intergenic
1113151506 13:107269036-107269058 GCCTGTGGTCCCACGTCCTTGGG + Intronic
1117399522 14:55345879-55345901 GCTTGTGGTTGCAGCTACTTGGG + Intronic
1118592267 14:67410619-67410641 ACATGATGTTGCACGTTATTTGG - Intronic
1119328582 14:73777125-73777147 GCATGTGGTTGGCCCTGCTTAGG - Intronic
1123816035 15:23980203-23980225 GCATGTAGTTGCAGCTGCTTGGG + Intergenic
1125850537 15:42899115-42899137 GCCTGTGGTTGCAGCTTCTCAGG - Intronic
1128520354 15:68370814-68370836 GCATGTGGTGGCTTCTTCTTTGG - Intronic
1130153862 15:81332936-81332958 GCATATTGTCGCACGTTCCTGGG + Exonic
1135695915 16:24586261-24586283 GGGTGTGGTGGCACGTTCTGTGG - Intergenic
1136107160 16:28038233-28038255 GCATGTGGTTCCAGCTACTTGGG - Intronic
1143628158 17:8122556-8122578 GCATTTGGTCGCGCGTTCTGTGG - Intronic
1146037635 17:29421721-29421743 GCATGTGGTTCCAGCTACTTGGG - Intronic
1148254135 17:46113305-46113327 CCACGTGTTTGCAGGTTCTTTGG + Intronic
1148991281 17:51669041-51669063 GGATGAGGTTGCAGGGTCTTGGG - Intronic
1151151565 17:72092323-72092345 GCCTGTGGTTGCAGCTACTTGGG + Intergenic
1153119733 18:1706934-1706956 GCCTGTATTTGCAAGTTCTTGGG + Intergenic
1157113147 18:44839872-44839894 GGATGTGATTGCACCTCCTTAGG + Intronic
1160002777 18:75043028-75043050 GCATGTGTTTTCATTTTCTTAGG + Intronic
1163449193 19:17365639-17365661 GCATGTGGTCGCAGGCTCTGCGG + Exonic
1163546903 19:17946152-17946174 GCCTGTGGTCCCACCTTCTTTGG + Intergenic
1167422255 19:49411062-49411084 GCCTGTGGTTGCAGCTACTTGGG - Intronic
926964785 2:18397931-18397953 TCATGTCATTGCACGTTGTTAGG + Intergenic
931224886 2:60321043-60321065 GTATGTGTTTGCAAGTTGTTGGG + Intergenic
938061306 2:128256979-128257001 GCCTGTGGTCCCACGTACTTGGG + Intronic
938947560 2:136226858-136226880 GCATGTTGATGCATGTTCCTGGG - Intergenic
939956842 2:148534426-148534448 GAATTTGGGAGCACGTTCTTGGG - Intergenic
940846086 2:158643585-158643607 GCCTGTGGTTCCAGGTACTTGGG + Intronic
944513417 2:200486751-200486773 GCCTGTGGTGGCAAGTTGTTCGG - Intergenic
1169450251 20:5704854-5704876 GCCTGTAGTTCCACCTTCTTGGG + Intergenic
1172405937 20:34689239-34689261 GCATGTGGTTTCAAATTCTCAGG + Intergenic
1180642075 22:17307034-17307056 GAATGTGATTCCACATTCTTGGG - Intergenic
1183435001 22:37788490-37788512 GCCTGTGGTTCCACGTACTGGGG + Intergenic
1184073697 22:42162830-42162852 GCATGTGCATGTACGTGCTTGGG - Intronic
1184791476 22:46702951-46702973 GCATGTGGTTGGTCGTTACTCGG - Intronic
950264795 3:11565594-11565616 ACATGTGGTGGCACGTGCTCTGG + Intronic
956376823 3:68622026-68622048 GCATCTGGAAGCACGTTCATAGG - Intergenic
957335199 3:78818712-78818734 GCATTTGTTTGCAAGTTCCTCGG + Intronic
958048165 3:88311512-88311534 GCATGTAATTTCACTTTCTTGGG + Intergenic
958699269 3:97567731-97567753 TCTTGTGGCTGCACGTTCATGGG - Intronic
959712423 3:109398395-109398417 GCCTGTGGTTGCAGCTACTTGGG + Intergenic
960097000 3:113698566-113698588 GCATGTGGTTCCAGCTACTTGGG - Intergenic
962986246 3:140538566-140538588 TCATGTGGTTGCACATTTTCAGG + Intronic
966395240 3:179495350-179495372 ACATGTGGTTCCACCTACTTGGG + Intergenic
972550373 4:40127340-40127362 GCCTGTGGTTCCACCTACTTGGG - Intronic
974029441 4:56762957-56762979 GCATGTGATTGGATGTTCTCAGG - Intergenic
978765078 4:112396900-112396922 GCATGTGGTTCCAGTTACTTGGG - Intronic
978793734 4:112688638-112688660 GCCTGTGGTTCCATCTTCTTGGG + Intergenic
983516219 4:168659397-168659419 CCATGTGGTTGCATGTGCTTTGG + Intronic
983824656 4:172243539-172243561 GCATGTTGTGGCAGGTTCTCAGG - Intronic
986580310 5:9258945-9258967 CCCTGTGGTTGCAGGTACTTGGG - Intronic
987443983 5:17993345-17993367 GCATGTGGTAGCAAGTGCTGTGG - Intergenic
988645937 5:33095144-33095166 GCTTGTGGTTGCAGCTACTTGGG - Intergenic
991222179 5:64229044-64229066 GCCTGTAGTTGCACCTACTTGGG - Intronic
995638197 5:114219699-114219721 GGCTGTGGTTGCAGGTTTTTTGG + Intergenic
1002977000 6:2089819-2089841 ACTTGTGGTTACACCTTCTTAGG + Intronic
1003198183 6:3933245-3933267 GCAGGTGGTTGCACCTTCCCAGG + Intergenic
1003408067 6:5839470-5839492 GCATGTGGTTGGATATCCTTAGG - Intergenic
1005683820 6:28232612-28232634 CCATGTGGTTCCACTATCTTAGG - Exonic
1006451832 6:34109836-34109858 TCATGTGGTTCCAAGTTCTCTGG + Intronic
1010410843 6:75559731-75559753 GCATGTGGTTCCAGCTACTTGGG + Intergenic
1017237178 6:152128902-152128924 GGTTGTGGTTGAACATTCTTGGG - Intronic
1018426141 6:163683931-163683953 GAATGTGGTTAGACGTTCTCAGG + Intergenic
1020320713 7:6937109-6937131 GCCTGTAGTTGCACCTACTTGGG - Intergenic
1023185670 7:37530509-37530531 GCATGTGGATTAACATTCTTTGG - Intergenic
1026335008 7:69386666-69386688 ACCTGTGGTTGCACCTCCTTGGG - Intergenic
1028889881 7:95975037-95975059 GGATGTGGTTGCAGTTCCTTCGG + Intronic
1030618399 7:111762889-111762911 GCCTGTGGTTCCAGTTTCTTAGG - Intronic
1036024034 8:4882569-4882591 GCTTGGGGTTGAATGTTCTTAGG - Intronic
1036481344 8:9142219-9142241 GCCTGTGGTCCCACTTTCTTGGG - Intronic
1037423535 8:18729487-18729509 TAATGTGGTGGCATGTTCTTAGG - Intronic
1039016661 8:33157005-33157027 GCCTGTGGTCACAGGTTCTTGGG + Intergenic
1039714458 8:40092644-40092666 GCAAGTGGTTGCATTCTCTTGGG + Intergenic
1042442999 8:68849417-68849439 GCCTGTGGTTCCAGGTACTTGGG - Intergenic
1043488507 8:80722979-80723001 GCATGTGGTTTCCAATTCTTTGG + Intronic
1045569682 8:103356016-103356038 GCCTGTGGTTCCAGGTACTTGGG + Intergenic
1047040829 8:120993390-120993412 TCATGTGATTGCACATACTTCGG - Intergenic
1047485332 8:125325472-125325494 GCTTGTGGTTCCAGCTTCTTAGG - Intronic
1049953224 9:666054-666076 GCCTGTGGTTGCAGCTACTTGGG + Intronic
1050523230 9:6523474-6523496 CCATGTGGTTTCAAGTTCTGTGG + Intergenic
1055510780 9:76993848-76993870 GCCTGTAGTTGCACCTACTTGGG - Intergenic
1059477527 9:114559786-114559808 GCCTGTGGTTCCAGGTACTTGGG - Intergenic
1186069827 X:5807312-5807334 GGATGTGGTTACACATTTTTAGG - Intergenic
1188226832 X:27610240-27610262 GCATATGGGTGTAGGTTCTTAGG - Intronic
1193593608 X:83419734-83419756 GCAGCTGGTTGCATGTTCATTGG - Intergenic
1194418413 X:93641766-93641788 GCATGTTGTTGCAAGTTACTGGG - Intergenic
1198555058 X:137783946-137783968 GCCTGTGGTTCCAGCTTCTTGGG + Intergenic
1199619983 X:149690715-149690737 GCATGCAGTTGCACCTTCTAGGG + Intronic