ID: 1078503584

View in Genome Browser
Species Human (GRCh38)
Location 11:11910258-11910280
Sequence AACACGGTGGTGAGTTCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 8, 3: 49, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078503578_1078503584 -5 Left 1078503578 11:11910240-11910262 CCTCAGCACCCAAGGAATAACAC 0: 1
1: 0
2: 4
3: 26
4: 184
Right 1078503584 11:11910258-11910280 AACACGGTGGTGAGTTCCATGGG 0: 1
1: 0
2: 8
3: 49
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078503584 Original CRISPR AACACGGTGGTGAGTTCCAT GGG Intronic
906870253 1:49471558-49471580 GACATGGTGGTCAGTTCCATGGG + Intronic
915712653 1:157916197-157916219 AACATGGTGCTGAGTTCCCTGGG - Intergenic
916140094 1:161689361-161689383 AAAATGGTGATGAGTTCCGTAGG - Intergenic
917505767 1:175625598-175625620 AACAGGGTGGTGAATCCCATGGG - Intronic
919334819 1:196219132-196219154 AACATGGTGGTGAATTCTGTGGG - Intergenic
920358125 1:205391337-205391359 GACAAGGTGGTGAGTTCCCAGGG + Intronic
921963489 1:221062323-221062345 AACACTGTGGAAAGTTCCCTGGG + Intergenic
922378951 1:225001195-225001217 GACATGGTGGTAAGTTCCCTGGG - Intronic
923381795 1:233427810-233427832 TACATGATGGTGAGTTCCCTGGG - Intergenic
924145765 1:241073042-241073064 CTCATGGTGCTGAGTTCCATGGG + Intronic
924266798 1:242290940-242290962 AAGACAGTGGGGAGGTCCATAGG - Intronic
924694326 1:246382973-246382995 AACCTGGTGGTGAGGTCCACTGG - Intronic
1066359411 10:34715677-34715699 ATCACCATGGTGAGTCCCATAGG + Intronic
1066659460 10:37726378-37726400 AAGAGGGTGGTGAGTGCCAAAGG - Intergenic
1070097556 10:73352565-73352587 GACACAGTGGTGAGTTCTTTGGG - Intronic
1072853868 10:98925905-98925927 AACATGATGGTGAGTTCCCTGGG - Intronic
1074480409 10:113815145-113815167 AACATGCTGGTTTGTTCCATAGG - Intergenic
1074974887 10:118572246-118572268 AACACAGTGGAGAGTTCCCTGGG + Intergenic
1075018461 10:118928741-118928763 TACACGGTGGTGAGTTTCTTGGG + Intergenic
1076118088 10:127914576-127914598 AACAAGCTGGAGAATTCCATAGG - Intronic
1078404254 11:11055498-11055520 TACACGGTGATGAGTTCCCTGGG - Intergenic
1078503584 11:11910258-11910280 AACACGGTGGTGAGTTCCATGGG + Intronic
1078769540 11:14335741-14335763 AACACTGTGGTGAGTTTCCTGGG + Intronic
1078873365 11:15369950-15369972 AACACAGAGGTGATTTCCATGGG - Intergenic
1079570884 11:21942204-21942226 AACAGGGTGGTGAGATCCCTGGG - Intergenic
1086359600 11:86044310-86044332 ATCATGATGGTCAGTTCCATAGG - Intronic
1088093176 11:106066965-106066987 AACATACTGGTGAGTTCCCTGGG + Intronic
1088300400 11:108352024-108352046 AACAAGGTGGTGACTCCCAAAGG + Intronic
1090257237 11:125293434-125293456 AACACTGTGGTGAGCTCCCCAGG - Intronic
1091440240 12:507327-507349 AACACTGTGGTGAGTTAAAAGGG - Intronic
1091893244 12:4079510-4079532 AACACAGTGATGAGTTCCCTGGG - Intergenic
1092293269 12:7178089-7178111 AACATGGTAATGAGTCCCATGGG - Intergenic
1095664471 12:44780215-44780237 AATATGGTAGTGAGTTCAATGGG + Intronic
1099275060 12:80564301-80564323 AACATAGTGGTGAATTCCTTGGG - Intronic
1100555454 12:95688692-95688714 AACACGGTGGAAACATCCATAGG + Intronic
1102504049 12:113372670-113372692 AACACGGTGGTGAATTACTGCGG + Exonic
1104116668 12:125755701-125755723 AGCAAGGTGGACAGTTCCATTGG + Intergenic
1105758693 13:23493484-23493506 AACATTGTGGTGAATTGCATGGG + Intergenic
1105782131 13:23714742-23714764 AAGAGGGTGGTGAGTGCCAAAGG - Intergenic
1106695127 13:32164678-32164700 GACATTGTGGTGAGATCCATGGG + Intronic
1108407629 13:50121639-50121661 AACAGGGTGGCTAGTTCCACAGG - Intronic
1114586441 14:23818011-23818033 AACACAGTGGTGAGGACCACGGG - Intergenic
1114928339 14:27433880-27433902 AGCACGGTGGCGAGTGCCTTTGG - Intergenic
1115579741 14:34746152-34746174 AAGACAGTGGTAAGTTCCCTAGG - Intergenic
1115632679 14:35261203-35261225 GACATGGTGGTGAGTTCCCTGGG - Intronic
1117791031 14:59342613-59342635 AGCACCGTGCTGAGTGCCATAGG + Intronic
1118048987 14:62005380-62005402 AACACAGTCGTGAGTTCCCTGGG - Intronic
1121502773 14:94451539-94451561 AAAATGGTGCTGAGTTCAATGGG - Intronic
1121684154 14:95819837-95819859 AACATGGTGGTGGGTTCCTTGGG + Intergenic
1126652420 15:50938160-50938182 GACACGGTGGTGTGTACCCTGGG + Intronic
1128051453 15:64668386-64668408 AACATGGTGATGAGTTCCCTGGG + Intronic
1128257100 15:66204952-66204974 AACATGGTGGTGTGTTCCTTGGG + Intronic
1128400619 15:67276411-67276433 AGCATGGTGGTGAGTTTCCTGGG + Intronic
1129578145 15:76776116-76776138 AGCAAACTGGTGAGTTCCATGGG + Intronic
1130830337 15:87592477-87592499 AACAAGGTGGTGAGTTCCCTGGG + Intergenic
1132422243 15:101680449-101680471 AACATGGTAGTGAGTTCCTTAGG - Intronic
1138312431 16:56039285-56039307 AACATACTGGTGAGTTCCCTGGG - Intergenic
1140466324 16:75185958-75185980 ACCTCTGTGGTGAGTTCCAGAGG + Intergenic
1144179618 17:12739755-12739777 AACCCCGTGGTTATTTCCATAGG - Intronic
1146151298 17:30475025-30475047 AACATGAAGGTGAGTTCCCTGGG + Intergenic
1149175785 17:53868410-53868432 AACACAATGATGAGTTCCCTGGG + Intergenic
1154171739 18:12057300-12057322 AAGAAGGTGGTGAGTTCCACTGG - Intergenic
1155082060 18:22420142-22420164 AATATGGTGGTGAGTTCCGTGGG + Intergenic
1156621553 18:38857549-38857571 AACATGGTGGTGAGTTCCCTGGG + Intergenic
1156884795 18:42122522-42122544 AACATGGTAGTGTGTTCCCTTGG - Intergenic
1158317115 18:56223497-56223519 AAATCAGTGGTCAGTTCCATTGG + Intergenic
1160933070 19:1579725-1579747 AACTCGGTGGTGGGTTCCGCAGG - Intronic
1167351835 19:48980137-48980159 GACGCGGTGGGGAGTCCCATGGG - Intronic
1167492800 19:49801881-49801903 AGCACTGTGGTGAGTCCCCTGGG + Exonic
1202633111 1_KI270706v1_random:18078-18100 AACACTGTGGTGACATCCTTAGG + Intergenic
1202652768 1_KI270707v1_random:21972-21994 AACACTGTGGTGACATCCTTAGG - Intergenic
926229409 2:10991240-10991262 GACACGAAGGTGAGTTCCCTGGG - Intergenic
927223429 2:20737164-20737186 AACACAGTGGTGAGTTCTCTGGG - Intronic
928342496 2:30456716-30456738 AATATGGTGGTGAGTTCCCTGGG - Intronic
928448359 2:31353541-31353563 GACATGATGGTGAGTTCCAGGGG + Intronic
929090320 2:38210309-38210331 AAAAATATGGTGAGTTCCATGGG + Intergenic
931567401 2:63629060-63629082 AACATGGTGGTGAGTTCTCTGGG + Intronic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
932495507 2:72144014-72144036 AACACGGTGTCCAATTCCATTGG - Exonic
935152016 2:100446276-100446298 GACATGGTGGTGAGTTCCTGGGG - Intergenic
939859727 2:147404085-147404107 AACATGGTGATAAGTTCCCTGGG + Intergenic
940050512 2:149457869-149457891 AACACAGTGCTGAGTTCACTAGG + Intronic
941791304 2:169554902-169554924 AGCAGGGTGATGAGTTCCCTAGG - Intronic
945321242 2:208425866-208425888 AACATGGTGGTAAATTCCCTGGG - Intronic
947183994 2:227438628-227438650 GACACAGTGGTGAGTTCCCTGGG + Intergenic
948263034 2:236618259-236618281 AACAGGGAGGTGAGTCCCACGGG + Intergenic
1170330885 20:15209228-15209250 AACACGGTGATGAGTTTTCTGGG - Intronic
1170802731 20:19603786-19603808 AACAAGGCTGTGAGTTCCAGGGG + Intronic
1171209978 20:23309488-23309510 AACATGGTGGCCGGTTCCATGGG - Intergenic
1172018806 20:31897995-31898017 TACATGGTGGTGAATTCCCTGGG - Intronic
1174717003 20:52770369-52770391 TACATGGTGGTGAGTTCTCTGGG + Intergenic
1174852427 20:54007915-54007937 AACACGATGGTGAATTCCTTGGG + Intronic
1174935830 20:54867148-54867170 AACACTGTGGTGAGTTCTGTGGG - Intergenic
1175475386 20:59269670-59269692 AACGGGGGGGTGAGTGCCATGGG + Intergenic
1176513429 21:7765815-7765837 AGCACGGTGGTGAGGAGCATGGG + Intronic
1176599384 21:8777681-8777703 AACACTGTGGTGACATCCTTAGG + Intergenic
1176645332 21:9343958-9343980 AACACTGTGGTGACATCCTTAGG + Intergenic
1178647542 21:34396339-34396361 AGCACGGTGGTGAGGAGCATGGG + Intronic
1180130927 21:45826680-45826702 GACATGGTGGTGAGTTCCCTGGG + Intronic
1180367620 22:11955276-11955298 AACACTGTGGTGACATCCTTAGG - Intergenic
1180419043 22:12797221-12797243 AACACTGTGGTGACATCCTTAGG - Intergenic
1181335125 22:22123471-22123493 AACAGGGTGGTGAGTACCAACGG - Intergenic
1181710153 22:24679506-24679528 AAGAGGGTGGTGAGTGCCAAAGG + Intergenic
1183133751 22:35866618-35866640 GACAGGGTGGTGAGTTCCTTGGG + Intronic
951989148 3:28656437-28656459 AGCACTGTGGCGAGTGCCATAGG - Intergenic
952177585 3:30882355-30882377 AACAGGATGGTGATTTCCAGTGG - Intronic
952580060 3:34823047-34823069 TACACAGTGGTGAATTCCTTGGG - Intergenic
952808738 3:37382208-37382230 GCCATGGTGGTGAGTTCCCTGGG - Intergenic
952868334 3:37873456-37873478 AATAGGGTGGTGATTTCCCTGGG - Intronic
954535461 3:51356315-51356337 AAAACAGTGGTGAGTTCCCAAGG - Intronic
954850927 3:53599824-53599846 AAGACGGTGGTGGGTTTCCTTGG - Intronic
955633520 3:61000682-61000704 AACAACCTGGTGAGTTCCGTGGG + Intronic
955830187 3:62993141-62993163 GACACAGTGGTGAGGTCCCTGGG - Intergenic
956088949 3:65643559-65643581 AACATGGTGATGAGTTTCATGGG + Intronic
956262830 3:67363919-67363941 AACACAGTGGTGAGTTCCCTGGG + Intronic
960150979 3:114248518-114248540 AACACAGTGGAGAGCTCCCTAGG + Intergenic
960745596 3:120884451-120884473 AACATGGTATTGACTTCCATAGG + Intergenic
961575170 3:127830167-127830189 AACATGGTGGTGAGTTCCCTGGG - Intergenic
962863129 3:139423106-139423128 GACACAATGGTGAGTTCCCTGGG + Intergenic
962948417 3:140195356-140195378 GACACAGTGGTGAGTTCTTTAGG - Intronic
1202741558 3_GL000221v1_random:61110-61132 AACACTGTGGTGACATCCTTAGG - Intergenic
969058405 4:4416119-4416141 AACACGGTGGTGTGACTCATTGG + Intronic
972501412 4:39681347-39681369 AACATGGTACTGAGTTCCCTGGG - Intergenic
973362743 4:49180052-49180074 AACACTGTGGTGACATCCTTAGG + Intergenic
973398354 4:49616801-49616823 AACACTGTGGTGACATCCTTAGG - Intergenic
974167522 4:58222840-58222862 AACACTTTGCTGAGTTCCTTTGG + Intergenic
977460212 4:97315651-97315673 AACACAGTGGTGAGTGCCCTTGG - Intronic
979958982 4:126992807-126992829 AACTCGTTGGTGAATTCCAAAGG + Intergenic
979996392 4:127436775-127436797 AATATAGTGGTGAGTTTCATAGG - Intergenic
983399458 4:167244730-167244752 AACAGGGAGGTGAGTTCACTGGG - Intergenic
986466669 5:8032957-8032979 GACACAGTGATGAGTTCCCTGGG - Intergenic
994630314 5:102276998-102277020 AACATAGTGGTGAGTTTCCTGGG + Intronic
996494738 5:124140833-124140855 AATATGTTGGTGAGTTCCCTGGG + Intergenic
997083424 5:130767573-130767595 AACATGGTGGTGATTGCCACTGG - Intergenic
997448652 5:133963564-133963586 AACATGGTGGTGACTTCCTTAGG + Intronic
999313963 5:150572148-150572170 AACACAGGAATGAGTTCCATTGG + Intergenic
999396531 5:151232735-151232757 AACATGGTGGACTGTTCCATGGG + Intronic
1000933490 5:167280854-167280876 ACAACAGTGGTGAGTTCCCTGGG - Intergenic
1000941640 5:167369154-167369176 TACATGGTGGTGAGTTCCCTGGG - Intronic
1001034094 5:168284595-168284617 GACATGGTGGTGAGTTCCCTGGG + Intergenic
1001896158 5:175383272-175383294 ATCACTATGGTGAGTTCCCTGGG + Intergenic
1001943319 5:175756169-175756191 AACACAGTGTTCAGTTCCCTGGG + Intergenic
1002384549 5:178856546-178856568 AACATGGTGATGAGTTCTCTGGG - Intergenic
1006195131 6:32235539-32235561 AATATAGTGGTGAGTTCCCTGGG - Intergenic
1006214761 6:32430757-32430779 GACAGAGTGGTGAGTTTCATAGG - Intergenic
1007954052 6:45900431-45900453 AACAGTGTGGTGAGGTCCTTAGG - Exonic
1008893097 6:56519106-56519128 AACACAGTGGTGAGTTCTCTGGG + Intronic
1011720928 6:90155998-90156020 AAAACTTTGGTGATTTCCATTGG - Intronic
1012219684 6:96633693-96633715 AACAAGGTGGTGAGTGCCGTGGG - Intergenic
1013726104 6:113097540-113097562 AACACAGTAGTGAGTTCCCAGGG - Intergenic
1013909899 6:115262641-115262663 AACACAGTGGTGAGTTCCCTGGG + Intergenic
1014022866 6:116610906-116610928 AACCCAGTGGTGAGTTCTCTGGG + Intergenic
1016403949 6:143710253-143710275 AACACGGTGGTGAGATTCCTGGG - Intronic
1017999777 6:159568930-159568952 AACACAGAGGTGAGTTCCCTGGG + Intergenic
1020207707 7:6131710-6131732 GACATGGTGGTGAGTTTCCTGGG - Intronic
1020646055 7:10815664-10815686 AACACTGTGGTAAGTACTATGGG + Intergenic
1021124517 7:16835811-16835833 AACACAGTGGTGAGTTCCCTGGG - Intergenic
1022156354 7:27665039-27665061 AACACGGTGGGAAGTTCCTTGGG + Intergenic
1022362004 7:29669891-29669913 AACATGGTTATGAGTTCCATGGG + Intergenic
1022533660 7:31082599-31082621 GCCACGGTGGTGATTTCCCTGGG + Intronic
1022699390 7:32743846-32743868 AACATGGTTATGAGTTCCATGGG - Intergenic
1023345129 7:39264096-39264118 AGCATGGTGGTGAGGACCATGGG + Intronic
1024137488 7:46425634-46425656 AACGGGGTGGTGAGTTCCCTGGG + Intergenic
1030261626 7:107570879-107570901 GACAGGGTGGTGAGTTCTCTGGG - Intronic
1032973742 7:137196723-137196745 AACACAGTGGTGAGTTCTGTGGG - Intergenic
1033135140 7:138777830-138777852 AACACAGAGGTGAGTTCTCTGGG + Intronic
1036943040 8:13069536-13069558 AAAAGGGTGGTGAGTTCAAGTGG - Intergenic
1038087951 8:24220973-24220995 AACATGGAGGTTTGTTCCATAGG + Intergenic
1039136242 8:34326342-34326364 AACATAGTGCTGAATTCCATAGG - Intergenic
1039294297 8:36132465-36132487 AACATGGTGGTGAGTTTTGTAGG - Intergenic
1041806346 8:61854008-61854030 AACACATTGGTGAGTTCCCTAGG + Intergenic
1042459506 8:69047049-69047071 AACATGGTGGTGGGTTTCCTGGG + Intergenic
1046455948 8:114461523-114461545 AACATGGTGGTGTGTTACATAGG + Intergenic
1047924914 8:129673472-129673494 AACACGTTGCTGTATTCCATGGG + Intergenic
1050976044 9:11939888-11939910 AGCACAGTGGTGAGTTCTCTGGG + Intergenic
1051468747 9:17411147-17411169 AACATGGTGGTGAGTTCTTTGGG + Intronic
1051969590 9:22871981-22872003 AACATGGCAGTGAGTTCCCTGGG + Intergenic
1052421618 9:28250378-28250400 AGCACAGTGGTGAGTTTCCTTGG + Intronic
1053146705 9:35717032-35717054 CACACTGTGCTGAGTTCCTTGGG + Intronic
1055558899 9:77503017-77503039 GACACGGTGTTGAGTTGCCTGGG - Intronic
1055692869 9:78852377-78852399 AACATGGTGGTGAGTTCCCTGGG - Intergenic
1056738164 9:89227275-89227297 GACAATGTGGTGAGTTCCCTGGG + Intergenic
1058281048 9:103115295-103115317 AACACAGTGGGGAGTTTCCTGGG + Intergenic
1061971559 9:134048084-134048106 TTCACGGTGCTGAGGTCCATCGG + Exonic
1203710193 Un_KI270742v1:91034-91056 AACACTGTGGTGACATCCTTAGG - Intergenic
1188249679 X:27877009-27877031 GACACTGTGGTAAGTTCCCTGGG - Intergenic
1189183760 X:39032332-39032354 AACACTGCTGTGAGTTCCCTGGG - Intergenic
1191729541 X:64318507-64318529 AACACGATTGTGAGTTTCATGGG - Intronic
1192188708 X:68977455-68977477 AATATGGTGGTGACTTCCTTGGG - Intergenic
1192308891 X:69992190-69992212 TACATGGCGGTGAGTTCCCTGGG - Intronic
1192637776 X:72836130-72836152 GACATGGTGGTGAGTTCCTTGGG + Intronic
1192643938 X:72884685-72884707 GACATGGTGGTGAGTTCCTTGGG - Intronic
1195641796 X:107183548-107183570 AATATGGTGGTGAGTTCCCTAGG + Intronic
1195821550 X:108950417-108950439 AACATGGTGGTGAGTTCCTTAGG - Intergenic
1195919989 X:109974207-109974229 CACAAAGTGGTGAGTTCCTTGGG - Intergenic
1196782960 X:119399497-119399519 AGCACGGTGGCGAGCTCCAGGGG - Exonic
1198180400 X:134202435-134202457 AACATGGCGTTGAGTTCCCTGGG + Intergenic
1201282626 Y:12354351-12354373 AACAAGGGGGTTAGTTACATTGG + Intergenic