ID: 1078503666

View in Genome Browser
Species Human (GRCh38)
Location 11:11910837-11910859
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 2, 1: 1, 2: 22, 3: 76, 4: 346}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078503666 Original CRISPR AATTGAAACCTGGACATTTG GGG (reversed) Intronic
900251737 1:1674381-1674403 AATTGAAACTTGGAACTCTGGGG - Intronic
902636969 1:17740941-17740963 GATTGAAACCTGCCCATTGGGGG - Intergenic
904638392 1:31902589-31902611 ATTTAGAACCTGGACATTTGAGG + Intergenic
904743697 1:32697773-32697795 ACTGGAAACCTGGACATGTATGG - Intronic
905332893 1:37219438-37219460 GACTGAAACCTGGACATTTTAGG - Intergenic
905604507 1:39285846-39285868 TCTTTTAACCTGGACATTTGAGG + Intronic
906357899 1:45123192-45123214 ATTTTAAACCTGGACATTTGGGG - Intronic
907205439 1:52766586-52766608 TATTGAAACCAGGACATTTTAGG + Intronic
908226235 1:62058957-62058979 AATGGAAACCTGGATTTTTATGG - Intronic
908577292 1:65474270-65474292 AATGGAAACCAGGACACCTGGGG + Intronic
908696618 1:66849483-66849505 AATTGAAACCTGGACATTTGGGG - Intronic
909172381 1:72313807-72313829 GATTGCCACCTGGACATTTAGGG - Intergenic
909568688 1:77084076-77084098 GATTGCCACCTGGTCATTTGAGG + Intergenic
909568872 1:77085588-77085610 CATTGCCACCTGGTCATTTGAGG - Intergenic
909881101 1:80879895-80879917 ACGTGAAACCTGTACATATGAGG + Intergenic
910175007 1:84420209-84420231 AATTGACATCTGGACAGTTGGGG - Intergenic
911390277 1:97232968-97232990 AATTGAAATCTTGACAATTTTGG + Intronic
912653829 1:111467771-111467793 AATTTAAACTTGGAATTTTGAGG + Intergenic
913194087 1:116440669-116440691 TATTGAAACCCGGACATTTGGGG + Intergenic
914349428 1:146827279-146827301 AACTGAAACCTGGACATTTTGGG - Intergenic
915709880 1:157885300-157885322 GATTGCCACCTGGACATTTGGGG + Intronic
915742507 1:158129889-158129911 AATTGTACACTGGACATTTTGGG + Intergenic
917280688 1:173375903-173375925 AATGGAACCATGGACCTTTGCGG - Intergenic
918034436 1:180853583-180853605 AATTGAAAACTGGACAGTTTGGG + Intronic
918687906 1:187442597-187442619 AATTGTAAGATGGATATTTGGGG - Intergenic
918768685 1:188523514-188523536 GATTGACACCTGGACACTTTTGG + Intergenic
919501814 1:198346842-198346864 AACTGTCACCTGGACATTTTGGG + Intergenic
919591963 1:199515171-199515193 AATTGAAAACTAAACATTTTAGG - Intergenic
919618392 1:199835555-199835577 GATTCAAACCTGAACATTTTGGG - Intergenic
920319402 1:205106640-205106662 AGTTGAAACCTGGGCATTTTGGG - Intronic
921963595 1:221063068-221063090 ATTTGAAACATGGACAGTTTGGG - Intergenic
922305878 1:224344148-224344170 TGTTGAAAACTGGACATTTTAGG + Intergenic
923499479 1:234552828-234552850 AATAGAAACGTGGATATTTATGG + Intergenic
923512698 1:234666190-234666212 AATGAAAACCTTGACATTTGGGG - Intergenic
1063104756 10:2983222-2983244 AATGGAAACCTTGACATTAATGG + Intergenic
1063303117 10:4871380-4871402 AATTAAAACCTGGACATTTTGGG + Intergenic
1063559864 10:7115875-7115897 AATTGAAACCTGCACAGCAGTGG + Intergenic
1063653662 10:7965318-7965340 AATTGAAAGATGGACTTGTGAGG + Exonic
1063954449 10:11253332-11253354 ACTTGACACCTGGACACTGGAGG - Intronic
1064026210 10:11850800-11850822 AATGGAAACATGACCATTTGTGG - Intronic
1064287762 10:14007254-14007276 AATTCAAACATGGGCTTTTGGGG + Intronic
1064437187 10:15321046-15321068 ATTTGACATCTGGTCATTTGGGG + Intronic
1065274330 10:24069993-24070015 AATTAAAACTTAGCCATTTGTGG - Intronic
1065404300 10:25346392-25346414 AATGGACACCTGTACTTTTGAGG - Intronic
1065698382 10:28401387-28401409 GATTGAGACCTGGATTTTTGGGG + Intergenic
1066105671 10:32154792-32154814 TGTTGAAACATAGACATTTGGGG + Intergenic
1068193617 10:53686949-53686971 AACTGAAACATGGACATTTTGGG - Intergenic
1068839425 10:61593423-61593445 GATTGAAACCTAGACATCTTTGG - Intergenic
1069028676 10:63572000-63572022 AATTCAAAGCTGGACGTTCGGGG + Intronic
1071484463 10:86089503-86089525 ATTTGAAACCTGGAAATTCTGGG - Intronic
1071938826 10:90563688-90563710 AAATGAAACCCTGTCATTTGTGG - Intergenic
1073039136 10:100587611-100587633 AATTGAAACTTGGATGTTTTGGG - Intergenic
1073750279 10:106518282-106518304 AATGGGAACCTGTGCATTTGTGG + Intergenic
1073918266 10:108430790-108430812 AATTACCACCTGGACACTTGGGG - Intergenic
1074097574 10:110327600-110327622 ACTTTAAGCCTGGACACTTGGGG + Intergenic
1074599125 10:114896007-114896029 AACTGCCACCTGGCCATTTGGGG + Intronic
1075147793 10:119897278-119897300 AATAGTAACGTGGACTTTTGAGG + Intronic
1075154218 10:119960844-119960866 AATAGAAAAATGTACATTTGTGG - Intergenic
1075907258 10:126092455-126092477 AATTGTTTGCTGGACATTTGGGG - Intronic
1075952115 10:126488560-126488582 AAATAAAACCTGGATATTTGGGG + Intronic
1076444799 10:130507097-130507119 AATGGAATCCTGAACATTTTAGG + Intergenic
1078503666 11:11910837-11910859 AATTGAAACCTGGACATTTGGGG - Intronic
1078899279 11:15626466-15626488 AATTCAGACGTGGACATTTTTGG + Intergenic
1079137170 11:17782164-17782186 AGTAGAAACCTGTACATTTCTGG + Exonic
1079272618 11:19002962-19002984 AATTTAAAGCTGGGCATGTGGGG + Intergenic
1079461256 11:20680222-20680244 AATTAGCACCTGGACATTTTTGG + Intronic
1080223662 11:29935276-29935298 GATTGAAATCTGGACAACTGAGG - Intergenic
1080741649 11:35069810-35069832 AATTAAAACCTGAACATTTGTGG - Intergenic
1081536347 11:43999284-43999306 ATTTTAAGCCTGGAAATTTGTGG - Intergenic
1085369139 11:75982106-75982128 GATTGAAACTTGGACATTTTGGG + Intronic
1085665003 11:78406663-78406685 TATTAAAACCTGGACATTTTTGG - Intronic
1086278831 11:85162075-85162097 AATTGCCACCTGGACACTTTGGG + Intronic
1086382695 11:86274427-86274449 GATTGAAACCTGGGTATTTTGGG + Intronic
1087135660 11:94716415-94716437 ACTTGTACCCTGGACATTTTGGG + Intronic
1087403688 11:97701729-97701751 AATTGAAACCCTAACATATGTGG - Intergenic
1087854108 11:103069910-103069932 AATTGAAACCTGGATATTTTGGG - Intronic
1087982851 11:104637987-104638009 AATTGAATGATGGACATGTGGGG + Intergenic
1088640420 11:111867709-111867731 AGTTGAAAGCTGGACATTTTAGG + Intronic
1088795278 11:113262129-113262151 AATTACAAGTTGGACATTTGTGG + Intronic
1089850839 11:121495164-121495186 GATTGAAGCCTGGAAGTTTGAGG - Intronic
1090815429 11:130289982-130290004 GATTAGAACATGGACATTTGGGG - Intronic
1091326072 11:134689100-134689122 AATTGCAACCTTGACAATTGTGG - Intergenic
1092483463 12:8881342-8881364 AAGTGAGATCTGGGCATTTGGGG + Intronic
1092839032 12:12520993-12521015 AATTGATAGCCGGCCATTTGTGG - Exonic
1092974093 12:13727448-13727470 GATTTACACCTGGTCATTTGGGG + Intronic
1093602582 12:21046710-21046732 AATTGAAAACCAAACATTTGTGG + Intronic
1094229671 12:28088567-28088589 AAATCAAACCTGAACATGTGAGG - Intergenic
1095545607 12:43364287-43364309 TGTTGAAAACTGGACATTTCAGG - Intronic
1095856028 12:46862053-46862075 AATTGCCACCTGGACACTTTGGG - Intergenic
1095902063 12:47338520-47338542 TATTGAAATCTGGACATTTGGGG + Intergenic
1096522855 12:52193868-52193890 GATGGGAACCTGGACAGTTGGGG + Intergenic
1097430048 12:59494186-59494208 AGCTGAAATCTGGACATTAGTGG + Intergenic
1097639702 12:62165484-62165506 AATAGGAAACTGGAAATTTGTGG - Intronic
1098210438 12:68158624-68158646 AATAGAAACCTGTACCATTGGGG - Intronic
1099107630 12:78516591-78516613 AAGTGGAACCTGGGCATATGAGG + Intergenic
1099574072 12:84359388-84359410 AATTGAAATCTGTACAAGTGAGG + Intergenic
1100240914 12:92709968-92709990 AATTGCCACCTGGACACTTTGGG - Intergenic
1100416647 12:94384960-94384982 AATGGAAACTTGGACATTTGGGG + Intronic
1100939376 12:99708832-99708854 AATTCCAACCTGGATATTTTTGG + Intronic
1101543633 12:105688791-105688813 TATTAAAACCTGGACATTTTGGG + Intergenic
1101894343 12:108744808-108744830 AATCAAAACCTGGACATTTTAGG + Intergenic
1101964196 12:109271152-109271174 AAGTGGACCCTGGACATTTCTGG - Intergenic
1104531527 12:129575698-129575720 GAATGAAACCTGTAGATTTGTGG + Intronic
1107021711 13:35759080-35759102 AATTAAGTCCTGGCCATTTGTGG - Intergenic
1107430894 13:40339178-40339200 AATTCAAACTAGGACATTTTGGG - Intergenic
1107983354 13:45754328-45754350 GATTGCCACCTGGACATTTTGGG - Intergenic
1108609704 13:52072034-52072056 AAATGAAACTTTGACCTTTGAGG - Exonic
1108860746 13:54855582-54855604 ATGTGAAACGTGGACACTTGAGG + Intergenic
1109673927 13:65647963-65647985 GATTGTAACCTGCACATTTTGGG + Intergenic
1109930340 13:69207818-69207840 AATTAATACCTGTATATTTGTGG - Intergenic
1110070341 13:71168139-71168161 AAATGAAAACTGGAAATCTGAGG + Intergenic
1111784557 13:92770739-92770761 AGCTGAAACCCGGACATTTGGGG + Intronic
1112354218 13:98660815-98660837 AATCGAGTCCTGGCCATTTGGGG + Intergenic
1113502798 13:110791088-110791110 AATTAAGACCTGGACATCTTGGG + Intergenic
1115107930 14:29783314-29783336 AAATGAAATCTTGTCATTTGTGG - Intronic
1116368249 14:44096857-44096879 AAATGAAAAGGGGACATTTGTGG - Intergenic
1116815054 14:49576157-49576179 CATTGAAACCTGGACCTCTTGGG + Exonic
1116829999 14:49709773-49709795 AATGGAAAGCTGTACATTTTTGG + Exonic
1116987184 14:51232878-51232900 CATTGAAAACTGGACATTTTAGG - Intergenic
1117442258 14:55771172-55771194 AACTGAAGTTTGGACATTTGAGG + Intergenic
1117653333 14:57928642-57928664 TATTGAAACCTGGACATTTTTGG - Intronic
1117754551 14:58960202-58960224 AATTTCAACCTGTAAATTTGGGG - Intergenic
1118164832 14:63326034-63326056 TGTTGAAACATGGACATTTTAGG - Intergenic
1119546598 14:75476524-75476546 TATGGAAAGCTGGACATTTGGGG + Intergenic
1120312215 14:82843675-82843697 CAATGAAACTGGGACATTTGAGG - Intergenic
1120360237 14:83491400-83491422 AATTTAAACATATACATTTGGGG + Intergenic
1120738244 14:88079059-88079081 AATTACAACCTGGACGATTGTGG - Intergenic
1121195431 14:92067708-92067730 AATTAAATCCTGAAAATTTGGGG + Intronic
1122176487 14:99924034-99924056 AATTGCCACCTGGACAATAGTGG + Intronic
1122377840 14:101278133-101278155 AATTGAAAACCTGACATTTTGGG - Intergenic
1123385509 15:19795139-19795161 AATCTGAAACTGGACATTTGGGG - Intergenic
1124170155 15:27365949-27365971 AATCAAAATCTGTACATTTGAGG - Intronic
1124185453 15:27523475-27523497 TATTGTATCCTGGACATTTCTGG - Intronic
1124723199 15:32131744-32131766 AATTATATCCTGGACATTTTGGG + Intronic
1125240210 15:37565354-37565376 GATTGAAACCTTGGCATTTTGGG - Intergenic
1128200453 15:65801350-65801372 AGTGGAAACCAGCACATTTGGGG + Intronic
1128867661 15:71126528-71126550 CATTGAAACCTGGACATTTTAGG - Intronic
1129000117 15:72326059-72326081 AATTGATTCCTGAACATTTTGGG + Intronic
1129089275 15:73131154-73131176 AACTGAAACCTGGATATTTTAGG - Intronic
1130392626 15:83472761-83472783 TATTAAAATCTGGGCATTTGGGG + Intronic
1130755502 15:86758679-86758701 AACTGATACCTGGCCAGTTGTGG + Intronic
1131531758 15:93199798-93199820 AATTGAAACCTGGATTTCAGTGG + Intergenic
1132150897 15:99457584-99457606 GACTGAAACCTGGACATTTGGGG - Intergenic
1136537347 16:30907857-30907879 AATTAAACCCTGGATATTTTGGG - Intergenic
1137531231 16:49280289-49280311 AAGGGAAACCTGGACATCTTTGG + Intronic
1137742811 16:50797152-50797174 ACTTCAAAAATGGACATTTGGGG - Exonic
1139115210 16:63943236-63943258 AATTGAAATCTGAATATTTGGGG + Intergenic
1139984608 16:70888275-70888297 AACTGAAACCTGGACATTTTGGG + Intronic
1141056703 16:80823021-80823043 TATTGTAAACTGCACATTTGAGG + Intergenic
1141413863 16:83855126-83855148 AATTGAAAGCTGGAATTGTGTGG - Intergenic
1141414115 16:83856902-83856924 AATTGAAAGCTGGAATTGTGTGG - Intergenic
1147766662 17:42841282-42841304 ATTTGAAACCAGGTTATTTGAGG + Intronic
1150154189 17:62836694-62836716 AGTTGAAACTTGGACATTTTTGG - Intergenic
1150818823 17:68418146-68418168 AATTGTAAGCTGGACATTGTTGG + Intronic
1151856276 17:76724409-76724431 AATTAAAACCTGGCCAGGTGCGG - Intronic
1152775436 17:82198649-82198671 AATTGTATCCTGGACATTTTGGG - Intronic
1153535785 18:6100552-6100574 GGTTGACACCTGGACATTTTGGG + Intronic
1153853100 18:9115554-9115576 AATTAAAAAATGGACACTTGGGG + Intronic
1154099990 18:11464191-11464213 TTTTGAAACCTGGACACTTTGGG + Intergenic
1154252334 18:12755124-12755146 AATTGCCACCTGGACATTTTGGG - Intergenic
1155744885 18:29342579-29342601 CATTGATATCTGCACATTTGAGG - Intergenic
1156020085 18:32589450-32589472 AATTGAAACCTTGACATGTTGGG - Intergenic
1156224779 18:35093593-35093615 AAATGAAATCTTGTCATTTGTGG + Intronic
1156284633 18:35679662-35679684 AATGGTAACCCGGATATTTGAGG - Intronic
1156423980 18:36988309-36988331 AGTTGAAACATGGAAATTTCAGG - Intronic
1157335045 18:46731926-46731948 AATTCAAACCTGGGCATGAGGGG + Intronic
1157524336 18:48368027-48368049 GATTGAAACCTGGAGATTTTTGG - Intronic
1158909742 18:62047758-62047780 TTTTGAAACCTAGACATTTTGGG - Intronic
1159017386 18:63112415-63112437 AATTAACTCCTGGCCATTTGGGG - Intergenic
1159047518 18:63383268-63383290 AATTGAAACCATGAAGTTTGGGG + Intergenic
1162150919 19:8645068-8645090 AATGGAAAGCTGGACAGGTGCGG - Intergenic
1164079578 19:21850971-21850993 ACCTGGAACCTGGACATGTGTGG - Intronic
1164198393 19:22993979-22994001 AAGTGTTACCTGAACATTTGTGG + Intronic
1165099382 19:33429794-33429816 ATTTGCAATCGGGACATTTGTGG - Intronic
1165182242 19:33981531-33981553 GATTGAGACCTGCACATTTTGGG - Intergenic
1166010771 19:39940947-39940969 AATTATATCCTGGACATTTCTGG + Intergenic
1166946712 19:46401735-46401757 AATTTAAACTTTGGCATTTGTGG - Intergenic
926548882 2:14276495-14276517 AATTGTGACCTGGACATTGTAGG + Intergenic
927429046 2:23011297-23011319 ATTTGAAATCTGGAAATATGAGG + Intergenic
929022556 2:37567958-37567980 CACTGAAGCCTCGACATTTGGGG - Intergenic
929414629 2:41734902-41734924 AATTGAAAGCAGGACAGTGGAGG + Intergenic
930487943 2:52031743-52031765 AATTTAAACCTGTACATTTACGG + Intergenic
930611597 2:53550410-53550432 TGTTGAAAACTGGACATTTTAGG - Intronic
931990153 2:67782099-67782121 TTTTCAAACCTGGAGATTTGCGG - Intergenic
932013237 2:67999195-67999217 ATTTGAAACCTGGATCATTGAGG + Intergenic
933399934 2:81783129-81783151 CATTGATACCTGCAAATTTGAGG + Intergenic
933553291 2:83802518-83802540 AGTTGAAACCAAGACATTTTAGG + Intergenic
934470932 2:94534504-94534526 AATCTGAAACTGGACATTTGGGG - Intergenic
934863336 2:97782424-97782446 GATTGAAACCTGGACCATTTGGG - Intronic
935535253 2:104285951-104285973 AGTAGAAACCTGGAGATCTGGGG - Intergenic
935624310 2:105156705-105156727 TATTGAGGTCTGGACATTTGGGG - Intergenic
935930404 2:108117994-108118016 AATCAAATCCTGGCCATTTGGGG + Intergenic
936002240 2:108844608-108844630 AATTGAAAACTAGACATTTTGGG + Intronic
936274074 2:111077928-111077950 TTCTGAAACCTGCACATTTGTGG + Intronic
936921024 2:117688179-117688201 TATTGAAACCTGGACATGTTTGG - Intergenic
938123752 2:128655495-128655517 AGTTGAAACCTGGAAAATTTTGG + Intergenic
938231074 2:129659926-129659948 TATTAAAACCTGGACATTTTAGG + Intergenic
938917078 2:135952692-135952714 AAGTGAAATCTTGTCATTTGTGG - Intronic
939805286 2:146768495-146768517 ACTTGAAGCCTGGAAGTTTGAGG - Intergenic
940825614 2:158408806-158408828 AATAGAACCCTGGACATTATTGG - Intronic
942013416 2:171787690-171787712 ACTTGAAACCAGGACAAATGTGG + Intronic
943480521 2:188411663-188411685 ATTGGAAACAAGGACATTTGGGG - Intronic
946151761 2:217778376-217778398 AATTGAAATCAAGACATTTTGGG - Intergenic
947808225 2:232982997-232983019 AATGGAACCCTTGACAGTTGTGG + Intronic
948067667 2:235093290-235093312 AAATGAAAAATGGAGATTTGGGG - Intergenic
948337200 2:237218606-237218628 GATTGAAACCTAAACATTTTGGG - Intergenic
948511629 2:238470002-238470024 AGTTGTATCCTGGACATTTTGGG + Intergenic
948580394 2:238983873-238983895 CATTGAATCCTGGCCACTTGGGG + Intergenic
1169003899 20:2191076-2191098 AAATGAATCAAGGACATTTGTGG - Intergenic
1169741854 20:8903412-8903434 AAATGAAACCTGGACACAAGTGG + Intronic
1169977564 20:11347350-11347372 AATTGAAACTGGGAGCTTTGGGG + Intergenic
1170385853 20:15815918-15815940 AATTGTAACCTGAATATCTGAGG + Intronic
1171943953 20:31359115-31359137 AAATGAAATCTTGTCATTTGCGG + Intergenic
1172835097 20:37868311-37868333 AATTCAAACCTTGAAATGTGTGG - Intronic
1173909696 20:46657432-46657454 GTTTGGAACCTGGACATTTTGGG + Intronic
1174934014 20:54847634-54847656 AATTTAAACTAGAACATTTGAGG + Intergenic
1174961127 20:55158685-55158707 AGTTGAAACCTGGCCATTTGGGG + Intergenic
1175463822 20:59175816-59175838 AATTGAGACTTGGACATTTTGGG + Intergenic
1177072755 21:16531566-16531588 GGTTGAAACCTGGACATCTTAGG + Intergenic
1177762552 21:25418500-25418522 GATAGAAACCTGGACATTTAGGG - Intergenic
1177999676 21:28146540-28146562 AATTGAAACTTGGCCATTTTTGG - Intergenic
1181367091 22:22386263-22386285 GATTGCCACCTGGACATTTTGGG - Intergenic
1182079088 22:27516511-27516533 AATTGACACCATGACATTTTGGG + Intergenic
1182204364 22:28608969-28608991 GGTTGAAAACTGGACATTTTAGG - Intronic
1182562561 22:31172195-31172217 AAGTGAAACCTGGCCAGGTGTGG + Intronic
1183048964 22:35245609-35245631 GATTGAAATCTGCACATTTGGGG + Intergenic
1183657054 22:39192407-39192429 TATTGAAAACTGGACATTGTGGG - Intergenic
1184420761 22:44381710-44381732 AATAGCAACCAGCACATTTGTGG - Intergenic
1184839956 22:47046722-47046744 AGTTAAAACCTGGACAAGTGCGG - Intronic
949537748 3:5008845-5008867 AATTGAGATCTGAACATTTGAGG - Intergenic
949879945 3:8653371-8653393 AATTGACATGTGGACATTGGAGG - Intronic
949942816 3:9167659-9167681 AGTTGCACCCTGGACATCTGGGG - Intronic
950226025 3:11235275-11235297 AATTGAAATATGGAAATTTTAGG + Intronic
951071745 3:18337322-18337344 TCTTGAAACCTGGATATTTTGGG + Intronic
952364163 3:32660276-32660298 AATTGAAATCTGTACATTGCTGG - Intergenic
953512283 3:43554510-43554532 AATAGAAACCTGGACATGTTAGG + Intronic
953729482 3:45434647-45434669 TATTGAAACCGAGATATTTGGGG + Intronic
953996789 3:47525979-47526001 TATTGGAAACTGGACATTTTAGG - Intergenic
954099723 3:48360441-48360463 GATGGAAACCTGAATATTTGGGG - Intergenic
958541922 3:95488385-95488407 AATTTAAACCTTAAAATTTGTGG + Intergenic
959283912 3:104382147-104382169 GATCAAAACCTGCACATTTGTGG - Intergenic
959488319 3:106955389-106955411 TATTGAAACCTGAACATTATGGG + Intergenic
959547981 3:107620451-107620473 CATTGAAACCTAGATATTTTGGG + Intronic
960273647 3:115701651-115701673 AAATCAACCATGGACATTTGGGG - Intronic
960476016 3:118129752-118129774 AATCAAAGCCTGGTCATTTGGGG - Intergenic
960762574 3:121090130-121090152 AATTAAAACCTGGACATTCCAGG + Intronic
961208244 3:125104563-125104585 AATTAAAAACTGGATAATTGTGG + Intronic
961317566 3:126050917-126050939 AGTGGACACCTGGACATTCGAGG - Intronic
961529226 3:127529740-127529762 GATTGAAGCCTGGATATTAGGGG - Intergenic
962399710 3:135047964-135047986 AGATGAAAGATGGACATTTGTGG + Intronic
962409966 3:135132568-135132590 AATTGAAGCATAGCCATTTGGGG + Intronic
963439578 3:145321012-145321034 CCATGAAACCTGAACATTTGTGG - Intergenic
965840599 3:172901607-172901629 CTTTGAAATCTGGACATTTTGGG + Intronic
966702419 3:182869852-182869874 ACTTGTTAGCTGGACATTTGGGG - Intronic
968154097 3:196364289-196364311 AATTGAACACTGGATATTTCAGG + Intronic
969832769 4:9811185-9811207 GATTGAAGTCTGGACATTGGGGG + Intronic
970741501 4:19244297-19244319 AAATGAAATCCTGACATTTGTGG - Intergenic
973120787 4:46519283-46519305 AATTGCCACCTGGACATGTTGGG - Intergenic
973897506 4:55429412-55429434 ATTGGAAACCTAGACATTTGAGG - Exonic
974107421 4:57486005-57486027 AGATAAAACCTGGACTTTTGAGG - Intergenic
974161396 4:58145327-58145349 AATTAAAACTTGGAGCTTTGAGG + Intergenic
974936937 4:68420089-68420111 CATTGAAACATATACATTTGTGG + Intergenic
975167563 4:71194727-71194749 ATTTTAAATCTGGAAATTTGTGG - Intronic
975275439 4:72494661-72494683 CATTGACATCTGCACATTTGAGG + Intronic
975652439 4:76607581-76607603 AACTGAAACCTGGTGGTTTGTGG - Intronic
975987076 4:80210587-80210609 AATTGGTGGCTGGACATTTGTGG - Intergenic
976091344 4:81461137-81461159 CATAGAAACCTGGCAATTTGAGG - Intronic
976359732 4:84163302-84163324 AAATGAATCCTAGAAATTTGTGG + Intergenic
977030959 4:91882805-91882827 TATTAAAACCTGAAGATTTGGGG + Intergenic
977443017 4:97094444-97094466 GATTGTATCCTGGACATTTTGGG + Intergenic
978484540 4:109236507-109236529 AATGGAAAAGTGGCCATTTGTGG - Intronic
978500320 4:109402470-109402492 AATTGAAAGTTGGCCATGTGTGG + Intergenic
979656859 4:123205387-123205409 ATTTGAAACCTGTAAATTTGGGG - Intronic
980629736 4:135415900-135415922 GATTGCCACCTGGACATTTTGGG + Intergenic
980957954 4:139447542-139447564 GATTGTCACCTGGACACTTGGGG + Intergenic
981190896 4:141861276-141861298 AATTGAAACCTGGATATTTTGGG - Intergenic
981774599 4:148351043-148351065 AATTGAAACACAGACACTTGAGG - Intronic
983170468 4:164530398-164530420 GATTGCCATCTGGACATTTGTGG - Intergenic
983369314 4:166839082-166839104 TACTGAAACCTAGACATTTGGGG + Intronic
983744391 4:171178141-171178163 AACTGAAACCTGGATATTCCAGG + Intergenic
984743757 4:183193503-183193525 AAATGCAACCTAGACACTTGTGG + Intronic
986531181 5:8738703-8738725 AATTGCTACCTGGACACTTTGGG - Intergenic
987176283 5:15313894-15313916 AATTAAAATCTAGACATTTTTGG - Intergenic
987186840 5:15430346-15430368 TATTGAGACCTGGACATCTTGGG + Intergenic
987858940 5:23458674-23458696 GAGTGAAACTGGGACATTTGGGG + Intergenic
989486158 5:41994730-41994752 GATTGCCACCTGGACATTTTGGG - Intergenic
990363977 5:55050594-55050616 GATTGAATCCTGGATATTTTGGG + Intergenic
990478196 5:56182645-56182667 GATTGAAACTTGGACTTTTGGGG + Intronic
990621401 5:57563434-57563456 ACTGGACACCTGGACATTTACGG - Intergenic
991697938 5:69290591-69290613 AAAAGAAACCTGGCCATGTGCGG - Intronic
992294727 5:75316673-75316695 AATTGAGCACTTGACATTTGGGG - Intergenic
992517374 5:77508661-77508683 TATTGAAAGCTGAACATTTTTGG + Intronic
992780649 5:80124162-80124184 AATCGAGTCCTGGCCATTTGGGG - Intronic
993595158 5:89845004-89845026 AATTGTATCCTGGACATTTTGGG - Intergenic
995131480 5:108635270-108635292 AATTAAATCATGGACATTTATGG + Intergenic
995738808 5:115333057-115333079 AATTGACATTTGGACATTTGAGG + Intergenic
996187741 5:120499826-120499848 AAATAAAACCTGGACATTTTAGG + Intronic
998597045 5:143542653-143542675 AATTGGACCCTGGAAATATGTGG + Intergenic
998772689 5:145564490-145564512 AACTGAAACCTGGAGATGAGAGG - Intronic
998788449 5:145738266-145738288 TATTGAAACTTGGATATTTTGGG - Intronic
999490095 5:152041617-152041639 AATTGAATTCTGTACATTTAAGG + Intergenic
1000009971 5:157221836-157221858 ATTTGAAATCTAGATATTTGTGG - Intronic
1000123928 5:158225136-158225158 AATTAAAACATGGACATATTTGG - Intergenic
1000596659 5:163222089-163222111 TATTGAAAACTGGACATTTTTGG - Intergenic
1000610811 5:163371555-163371577 CATTGATGCCTGTACATTTGAGG - Intergenic
1001531934 5:172469473-172469495 GATTGAAACTTGGACATTTTGGG + Intergenic
1001896247 5:175384051-175384073 CATTGAATCCTGGACATTTTAGG - Intergenic
1002776835 6:335536-335558 AATTTAAAACTGCCCATTTGTGG - Intronic
1003028007 6:2576043-2576065 TATTGAAGCCTGGACATTTTTGG + Intergenic
1005638956 6:27776580-27776602 AATTGTAAACTGCCCATTTGAGG - Intergenic
1006001773 6:30970699-30970721 AATTGCCACCTGGACACTTTGGG + Intergenic
1006261027 6:32870471-32870493 AATTGAAACTTGGACATTTCAGG - Intergenic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1007185442 6:39967222-39967244 GATTGAACCCTGGAAATTTGGGG - Intergenic
1009912679 6:69951939-69951961 AAATGAAATCTGAATATTTGAGG - Intronic
1010028560 6:71247509-71247531 TTTTGATACCTGCACATTTGAGG - Intergenic
1010361103 6:74995394-74995416 ATTTGCAAACTGGACTTTTGTGG - Intergenic
1010818852 6:80390035-80390057 GATTGCAACCTGGACACTTTGGG + Intergenic
1011278873 6:85656911-85656933 AATTGGAACCTGAATCTTTGAGG - Intergenic
1011376077 6:86688164-86688186 TATTGAAACCTGTACTGTTGGGG - Intergenic
1011403764 6:86993746-86993768 TATTACAACCTGGACATTTTGGG - Intronic
1011820788 6:91251656-91251678 ATTGGAGACCTGGACATTTCTGG - Intergenic
1012412378 6:98973583-98973605 AATCAAATCCTGGCCATTTGGGG + Intergenic
1012730662 6:102875911-102875933 GATTGACACCTGGACACTTTGGG + Intergenic
1013956201 6:115843993-115844015 AACTGAAACATGAATATTTGTGG - Intergenic
1014295613 6:119613904-119613926 GACTGAAACCTGTACATTTTGGG + Intergenic
1014416528 6:121191378-121191400 AATTGAAAGCTTCAGATTTGAGG - Intronic
1014709072 6:124785463-124785485 AATTGAAACATGGACATTTGGGG + Intronic
1014981934 6:127955209-127955231 AATTGAAACCTGGAAATCTGAGG - Intergenic
1015273427 6:131360011-131360033 AATTGAAATGTGGACTTTTCTGG - Intergenic
1015762850 6:136683763-136683785 AACTGAAATCTAGACATTTCTGG + Intronic
1016586350 6:145690566-145690588 TATTGAAACCTAGACATTTTGGG - Intronic
1016797936 6:148137789-148137811 AATGAAATCCTGGCCATTTGGGG + Intergenic
1017929117 6:158937376-158937398 ACTAGAAACCTGGACAATTGTGG + Intergenic
1017941711 6:159058886-159058908 AATCGAAACCTTTGCATTTGAGG - Intergenic
1018012570 6:159685060-159685082 TATTGAAATCTGTTCATTTGTGG - Intronic
1018194558 6:161343729-161343751 AAATAAAACCTGGACAGTTAGGG - Intergenic
1018656927 6:166046018-166046040 AAAAGAAACCTGCACATTTGAGG - Intergenic
1018738787 6:166711336-166711358 AATTGGAACCTAGACTTTTGGGG - Intronic
1019864989 7:3699195-3699217 ACTAGAAACCTGGACATTAGGGG - Intronic
1020150268 7:5676603-5676625 AAAAGATACCTGGACATTAGAGG + Intronic
1020454647 7:8357850-8357872 AAGTGAAACCTAGGCATTTGAGG - Intergenic
1020822707 7:12989823-12989845 TATTGAAAGCTAGACATTTTAGG - Intergenic
1020999509 7:15311086-15311108 AATTAAAACATGGACATATTTGG + Intronic
1021130162 7:16902162-16902184 CACTGAAACCTGGACATTTTTGG + Intergenic
1021152893 7:17173687-17173709 AGTTGAAATGTGGTCATTTGAGG + Intergenic
1021191642 7:17627213-17627235 AAATGAAACCATGACTTTTGTGG + Intergenic
1021504516 7:21366980-21367002 ATTTTAAATCTTGACATTTGAGG + Intergenic
1022224352 7:28347640-28347662 TATTGAAACCTGGACACTCTGGG - Intronic
1022284284 7:28940301-28940323 AATTAGAATCTGGTCATTTGGGG - Intergenic
1023803550 7:43855165-43855187 AATTGGAACATGCACATCTGTGG + Intergenic
1023919340 7:44615169-44615191 ACTTGCAACCTGGACATTCTGGG + Intronic
1023925224 7:44664091-44664113 TATTGAAACCAGGACATTTTGGG + Intronic
1024203997 7:47138014-47138036 AATTAAAACATGGAGATTTTTGG - Intergenic
1024526255 7:50352114-50352136 AGTTGAAATCTGGACTGTTGTGG - Intronic
1024528187 7:50367411-50367433 AATAGAAACCTGAAGATTTGAGG + Intronic
1024913182 7:54469464-54469486 AGCTGAAACCAGGACACTTGAGG - Intergenic
1025161646 7:56666540-56666562 AAGTGAAGCCAGCACATTTGTGG + Intergenic
1025223822 7:57139462-57139484 AAGTGAAGCCAGGACATTTGTGG + Intronic
1025745841 7:64241957-64241979 AAGTGAAGCCAGCACATTTGTGG - Intronic
1025866113 7:65382741-65382763 AAGTGTTACCTGCACATTTGTGG - Intronic
1026401290 7:70016274-70016296 AATAGAAACCTGGAATATTGCGG - Intronic
1027170592 7:75869338-75869360 AATTGAAACCAGCAGATTTCTGG + Intronic
1028001242 7:85500954-85500976 AATTGGATCCTTGACTTTTGGGG + Intergenic
1028058086 7:86273870-86273892 GATTGAAATGTGCACATTTGGGG + Intergenic
1028342653 7:89741303-89741325 AAATGAAACCAAGACTTTTGTGG + Intergenic
1029663909 7:101981898-101981920 ACTTGAAACCTGGCCAGGTGCGG - Intronic
1030489540 7:110214395-110214417 AATTTAAAGCTGGGCATTCGGGG - Intergenic
1030550132 7:110947958-110947980 TAGTGAAACCTGTATATTTGGGG - Intronic
1031002092 7:116427556-116427578 AAATGAAACATGGATATGTGTGG - Intronic
1031024316 7:116663640-116663662 AATTGGAACTTGCACAATTGTGG + Intergenic
1034076345 7:148235385-148235407 GGTTAAAACATGGACATTTGAGG - Intronic
1034190163 7:149207661-149207683 AATAGCACCCTGGATATTTGTGG + Intronic
1035133060 7:156673959-156673981 ATTTGAAACCTGGACAGTCATGG + Intronic
1035756628 8:2037616-2037638 GATTGAAACCTAGACATTTTGGG + Intergenic
1035832527 8:2712984-2713006 AAATAAAACCTCGACATCTGTGG - Intergenic
1036608531 8:10329579-10329601 GATTGGAACATGGACATTTTGGG + Intronic
1037212832 8:16413073-16413095 AACTGAAGCCTGGAACTTTGTGG - Intronic
1037334583 8:17779891-17779913 AATTCAAACCTGGAGCTTTGGGG - Intronic
1037416808 8:18660042-18660064 GATTGGGACCTGGACATTAGGGG - Intronic
1037667962 8:20987153-20987175 TATTGAAACCTGGATATTTTGGG - Intergenic
1038080706 8:24133113-24133135 AAGATAAATCTGGACATTTGAGG + Intergenic
1038516400 8:28191203-28191225 AACTGAAACCTGCACATTTGTGG - Intergenic
1038575085 8:28698258-28698280 ATTTTAAACAAGGACATTTGAGG + Intronic
1039121095 8:34147027-34147049 AATTGAAATCTGGAACTTTGGGG - Intergenic
1039294193 8:36131632-36131654 AATTGAGAACTGGAAATTTGAGG + Intergenic
1040273030 8:45978904-45978926 AATTGGCAAGTGGACATTTGGGG + Intergenic
1041019765 8:53627056-53627078 AATTGTAACCAGGGCAATTGTGG + Intergenic
1041966819 8:63687690-63687712 AAATGAAAGCTGGCCATTGGAGG + Intergenic
1042058464 8:64791307-64791329 AATTAGGACATGGACATTTGAGG - Intronic
1042062532 8:64836738-64836760 AATAGAAATTTGGACATTTTGGG + Intergenic
1043524604 8:81082977-81082999 CATTGAAACCTGGACATTTTGGG + Intronic
1043675811 8:82952378-82952400 AATTGGAACCTGCACTTGTGAGG + Intergenic
1043945035 8:86240110-86240132 TATTGAAAACTGGACATTTTGGG - Intronic
1043986983 8:86705419-86705441 AATAGGAGCATGGACATTTGCGG - Intronic
1044151014 8:88774705-88774727 AATTGCCACCTGGACATTTTGGG + Intergenic
1044290888 8:90468023-90468045 AGTTGACCCCTGGACATTGGTGG - Intergenic
1044906369 8:97008337-97008359 AATTTATGCCTGGACATTTTAGG + Intronic
1046917638 8:119693873-119693895 AATTGAAACCTTCATATTTAGGG + Intergenic
1047787814 8:128170782-128170804 AACTTAAACCTGTACATTTCTGG - Intergenic
1047908721 8:129501932-129501954 ATTTAAAACCTGGACATATTTGG - Intergenic
1048416543 8:134233141-134233163 AGTTGAAACCAGGACAATTCGGG - Intergenic
1050158209 9:2690352-2690374 AATTGAAATCTGGGCTTTGGGGG + Intergenic
1050830937 9:10011678-10011700 TGTTGAACTCTGGACATTTGTGG + Intronic
1050871762 9:10580027-10580049 TATAGAAACCTGAACATTAGAGG + Intronic
1052390487 9:27873258-27873280 GATTTAAACATGGACCTTTGAGG - Intergenic
1052526319 9:29624310-29624332 ACTTTAAACCTGGAAATTCGTGG + Intergenic
1052528526 9:29652802-29652824 GATTGAATTTTGGACATTTGGGG + Intergenic
1052737109 9:32353936-32353958 GATTGCCACCTGGACACTTGGGG - Intergenic
1053472661 9:38358011-38358033 CATAGAAACCTGGAGACTTGGGG - Intergenic
1055940742 9:81647164-81647186 AATAGAAACCTGGCATTTTGTGG + Intronic
1056267519 9:84914402-84914424 TATTGAAATCTGGACATTTGTGG + Intronic
1056859573 9:90167671-90167693 TATTGTATCCTGGACATTTGGGG + Intergenic
1057327481 9:94079065-94079087 TGTTGAAAACTGGACATTTTAGG + Intronic
1057571104 9:96204683-96204705 GAGGGAAACCTGGATATTTGGGG - Intergenic
1057962323 9:99468798-99468820 AAGTAAAACATGGACATTTTTGG - Intergenic
1058586471 9:106511785-106511807 TGTTGAAACCTGGACATTTTGGG - Intergenic
1059370346 9:113825752-113825774 AACTAAAACCTGGACATTTTGGG - Intergenic
1059738516 9:117126834-117126856 AATGGAAATCTAGACATATGAGG - Intronic
1062706779 9:137949988-137950010 AGTTGAAAACTGGCCATTTTTGG + Intronic
1187303587 X:18074724-18074746 AATTGAATCATGGCAATTTGAGG + Intergenic
1187690133 X:21857710-21857732 AAATGAATCCTGCACATTTAAGG + Exonic
1188258480 X:27993066-27993088 AACTGAAAGCTGGTTATTTGAGG - Intergenic
1189820727 X:44868149-44868171 TATTGAAACCTGGATATTTTGGG + Intergenic
1190034285 X:47005995-47006017 TACTAAAACCTAGACATTTGGGG - Intronic
1190447789 X:50546959-50546981 AGTTGAAACTTGGACATTTGGGG - Intergenic
1190447820 X:50547221-50547243 AGTTGAAACTTGGACATTTGAGG - Intergenic
1190482936 X:50895657-50895679 AAATGAAATCTTGTCATTTGTGG + Intergenic
1190814849 X:53920903-53920925 TATTGAAACCTGGATATTTGGGG + Intergenic
1190827777 X:54033222-54033244 AATTATATTCTGGACATTTGGGG - Intronic
1190839403 X:54130475-54130497 CATTGAAAACTGGACATTTTGGG + Intronic
1190894176 X:54600143-54600165 TATTAAAATCTGGACATTTTGGG + Intergenic
1190976792 X:55411940-55411962 TATTGAAACCTGGGCATTTTGGG + Intergenic
1191870584 X:65741728-65741750 AATTGAAACCTGGAATTGTGGGG + Exonic
1195409734 X:104556824-104556846 TGTTGAAACCTGGACATTTTAGG - Intergenic
1196643363 X:118089711-118089733 GATGGCAACCTGGACATTTTAGG - Intronic
1197477163 X:126939932-126939954 GATTGACACCTGGACACTTTGGG - Intergenic
1197536676 X:127697591-127697613 AAATGAAACCTACACATATGAGG - Intergenic
1197931919 X:131704887-131704909 AAAAGAGACCTGGACATTGGCGG - Intergenic
1198420216 X:136464601-136464623 TATTGTATCCTGGACATTTGGGG + Intergenic
1199533466 X:148875558-148875580 ATTTGAAACATGGTCATCTGTGG + Intronic
1199669321 X:150129324-150129346 CATGGAAACCTGGATATTTCAGG + Intergenic
1199738176 X:150704813-150704835 CATTAAAATCTGCACATTTGGGG - Intronic
1200412518 Y:2875629-2875651 ATTTGAAACTTGAACATTTAGGG + Intronic
1201674079 Y:16559528-16559550 AATAGAAACTTGGAAATTTGGGG - Intergenic
1202053052 Y:20801080-20801102 ATTTGAAACTTGAATATTTGAGG + Intergenic
1202080315 Y:21077506-21077528 ACTTCAAACCAGGACATGTGTGG + Intergenic