ID: 1078506757

View in Genome Browser
Species Human (GRCh38)
Location 11:11956285-11956307
Sequence TAGGGCAGTCCAATCAGTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078506757_1078506765 23 Left 1078506757 11:11956285-11956307 CCAGCACTGATTGGACTGCCCTA 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1078506765 11:11956331-11956353 AATGGGCCACTGTTTTGACTCGG 0: 1
1: 0
2: 0
3: 11
4: 127
1078506757_1078506761 5 Left 1078506757 11:11956285-11956307 CCAGCACTGATTGGACTGCCCTA 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1078506761 11:11956313-11956335 ATCAGAAGCTCAGTGCCCAATGG 0: 1
1: 0
2: 1
3: 11
4: 149
1078506757_1078506762 6 Left 1078506757 11:11956285-11956307 CCAGCACTGATTGGACTGCCCTA 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1078506762 11:11956314-11956336 TCAGAAGCTCAGTGCCCAATGGG 0: 1
1: 0
2: 0
3: 13
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078506757 Original CRISPR TAGGGCAGTCCAATCAGTGC TGG (reversed) Exonic
913077461 1:115353129-115353151 TAGGGAAGTCCCCTCAGTGATGG - Intergenic
919797826 1:201331977-201331999 TATGGCATACCAATCTGTGCGGG + Exonic
923367546 1:233277625-233277647 CAAGGCAGTCCAATTAGAGCAGG + Intronic
923446018 1:234072156-234072178 TAGGACAATCCTAACAGTGCTGG + Intronic
1062939507 10:1410890-1410912 GAGGGCAGTCCAGTCAGTTACGG + Intronic
1063312952 10:4972657-4972679 TAGCGCAGGGCAATCAGGGCTGG - Exonic
1063315041 10:4995389-4995411 TAGCGCAGGGCAATCAGGGCTGG + Exonic
1063325958 10:5102558-5102580 TAGCGCAGGGCAATCAGGGCTGG - Exonic
1063335895 10:5213067-5213089 TAGCGCAGGGCAATCAGGGCTGG - Exonic
1064589131 10:16870466-16870488 TAGGGCAATCCTACCAGTGCTGG - Intronic
1073144598 10:101272311-101272333 TAGGGTACTGCAAGCAGTGCGGG + Intergenic
1075077136 10:119359102-119359124 TAGGGGACTCCAAACAGTGGAGG - Intronic
1075322424 10:121502807-121502829 TAGGGCTGTCCACTCACTTCTGG - Intronic
1077555139 11:3222357-3222379 TTGGGCACTTCAAACAGTGCTGG + Intergenic
1078506757 11:11956285-11956307 TAGGGCAGTCCAATCAGTGCTGG - Exonic
1084808766 11:71599358-71599380 AAGGGCAGTTCAATGAGTGCAGG + Intronic
1087889690 11:103523114-103523136 TAGGGCAGTTCTTTCAATGCAGG - Intergenic
1089170388 11:116507585-116507607 TGGGGCTGTCCACTCAGGGCTGG + Intergenic
1102187153 12:110957750-110957772 CAGAGCAGTGCAATCAATGCTGG - Intergenic
1116541907 14:46110035-46110057 TAGGGCATTCCCATCTGTGGTGG + Intergenic
1117184690 14:53227787-53227809 TAGGCCAATCCAATCAGGGAGGG + Intergenic
1125278935 15:38024279-38024301 CATGGCAGTCAACTCAGTGCTGG + Intergenic
1125390112 15:39183630-39183652 TTGGGCAGAACAATCAGTCCTGG + Intergenic
1126007403 15:44271210-44271232 TTGGACAGTTCTATCAGTGCTGG - Intergenic
1132394918 15:101465308-101465330 CAGGGCTGTAGAATCAGTGCGGG - Intronic
1136601904 16:31297807-31297829 TGGGGCAGCCCTAACAGTGCTGG + Exonic
1138902439 16:61289506-61289528 AAGGGCAGTTCATACAGTGCCGG - Intergenic
1143338183 17:6189153-6189175 TAAGAAAGTCCAATCAGGGCCGG - Intergenic
1145279512 17:21457597-21457619 TAGGGCAGTCCAGGCAGGGGGGG - Intergenic
1151036069 17:70801468-70801490 CAGAGCAGGCCAATCAGTGGAGG - Intergenic
1161080798 19:2309036-2309058 TGCGGCAGACCAAACAGTGCAGG - Intronic
1165295841 19:34925426-34925448 TGGGGCAGTCCAAGGAGAGCCGG - Intergenic
1167329270 19:48844586-48844608 GAGGGCTGGCCAATCAGTGATGG + Intronic
927089069 2:19696693-19696715 GAGGGCAGGCCAATCAGGGAAGG + Intergenic
928141392 2:28732483-28732505 CAGGGAAGGCCAATCAATGCTGG + Intergenic
928146300 2:28779934-28779956 CAGGGAAGGCCAATCAATGCTGG - Intronic
936469002 2:112781198-112781220 TACAGCAGTCCAATGAGTGGGGG + Intronic
1171285946 20:23938178-23938200 TGGGGCAGTGCTGTCAGTGCTGG + Intergenic
1176921744 21:14695927-14695949 TAGGCCAATGCAATCAGTGATGG + Intergenic
1182283981 22:29233284-29233306 TAGGGCAGTCCAAGCTGTCTTGG + Intronic
1183829323 22:40409550-40409572 TTGGGCAGCTCCATCAGTGCAGG - Intronic
950446704 3:13042796-13042818 TAGGACTGTCCAGCCAGTGCCGG - Intronic
951027114 3:17841978-17842000 TATGCCAATCCAATCTGTGCTGG - Intronic
958726468 3:97911267-97911289 TAGTGCAGGCCTGTCAGTGCAGG + Intronic
966142392 3:176770878-176770900 TGGGGCAGTCAAAAGAGTGCTGG - Intergenic
971941085 4:33216073-33216095 TATGGCAGGCCTTTCAGTGCAGG + Intergenic
975502332 4:75100440-75100462 TGGGGCAGTCAAGTGAGTGCTGG - Intergenic
976339814 4:83934568-83934590 TAGGACATTTCCATCAGTGCAGG + Intergenic
979597847 4:122554432-122554454 TTGGCCAGTCCAGTCTGTGCAGG - Intergenic
981581866 4:146257507-146257529 TAGGGTAGTTCAGCCAGTGCTGG - Intronic
998038658 5:138937167-138937189 TAGGTCAGTCCAGTGAGGGCTGG - Intergenic
1002695393 5:181085106-181085128 CAGGGAAATGCAATCAGTGCCGG + Intergenic
1005278156 6:24242344-24242366 GAGGGCTGGCCAGTCAGTGCAGG - Intronic
1010444714 6:75936985-75937007 TCTGGCAGTCCAACCAGTGTTGG + Intronic
1012206136 6:96462656-96462678 CAGGGCAGTTCAATAAGTACAGG + Intergenic
1021918152 7:25456015-25456037 CAAGGCAGTCCAGTCTGTGCCGG + Intergenic
1022471831 7:30686328-30686350 TAGAGCATTCCAATGGGTGCTGG - Intronic
1022536067 7:31099312-31099334 TAGGACATTCCCATCACTGCAGG - Intronic
1022767927 7:33436133-33436155 TAGGGCAGCCCAAACTGTGTTGG - Intronic
1024181442 7:46899387-46899409 TAGGTGAGTCCAATAAGTGTTGG - Intergenic
1038061094 8:23913806-23913828 TAGGGCATTTCTATCATTGCAGG + Intergenic
1041616142 8:59908224-59908246 TAGTGCAGTCCCAGCAGTGGTGG + Intergenic
1044649047 8:94475166-94475188 TAGGGTCGTCCAATCAGAGTAGG - Intergenic
1059365094 9:113780781-113780803 GAGGGCAGTGGAACCAGTGCTGG - Intergenic
1060557614 9:124517082-124517104 TTGGGCACTTCAGTCAGTGCTGG + Intergenic
1062467094 9:136686299-136686321 CTGGGCAGTCCAAACAGGGCAGG + Intronic
1187035905 X:15539075-15539097 TATGACAGTCCAATCACTGAAGG - Intronic
1187247326 X:17564457-17564479 CAGGACAGTACAATAAGTGCTGG - Intronic
1187275906 X:17816554-17816576 GAGGGAAGTCCAAGCAGGGCTGG - Intronic
1192455314 X:71271004-71271026 TGGTGCAGTCCAATTAGTGGGGG - Intergenic
1193318456 X:80092466-80092488 TGTGGCAGGCCAATCAGTTCTGG + Intergenic
1198447786 X:136735555-136735577 CTGGGCAATCCAACCAGTGCGGG + Intronic
1198968708 X:142255202-142255224 CAGGGCATTCCAATCAGAGATGG + Intergenic