ID: 1078507331

View in Genome Browser
Species Human (GRCh38)
Location 11:11961986-11962008
Sequence TTGTGGCTATCATGACAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078507329_1078507331 -3 Left 1078507329 11:11961966-11961988 CCTCTCGTGTTCTTACAAGTTTG No data
Right 1078507331 11:11961986-11962008 TTGTGGCTATCATGACAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078507331 Original CRISPR TTGTGGCTATCATGACAAAA TGG Intergenic
No off target data available for this crispr