ID: 1078507444

View in Genome Browser
Species Human (GRCh38)
Location 11:11962964-11962986
Sequence AGAGGTGTGCTTCAGTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078507439_1078507444 21 Left 1078507439 11:11962920-11962942 CCATCCAAAAATAGTTAAGATTT 0: 1
1: 0
2: 5
3: 40
4: 395
Right 1078507444 11:11962964-11962986 AGAGGTGTGCTTCAGTTGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 164
1078507438_1078507444 22 Left 1078507438 11:11962919-11962941 CCCATCCAAAAATAGTTAAGATT 0: 1
1: 0
2: 0
3: 16
4: 270
Right 1078507444 11:11962964-11962986 AGAGGTGTGCTTCAGTTGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 164
1078507440_1078507444 17 Left 1078507440 11:11962924-11962946 CCAAAAATAGTTAAGATTTCTAA 0: 1
1: 1
2: 1
3: 39
4: 553
Right 1078507444 11:11962964-11962986 AGAGGTGTGCTTCAGTTGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078507444 Original CRISPR AGAGGTGTGCTTCAGTTGGG TGG Intergenic
902101853 1:13996815-13996837 GGGGGTGTGCTTCGCTTGGGGGG - Intergenic
904714864 1:32459897-32459919 AGAGCTGTGCTTGAGTAGGATGG - Intergenic
905069401 1:35212176-35212198 AGAGGATTGCTTGAGGTGGGAGG - Intergenic
907650276 1:56288166-56288188 AGAGGTTTACTTAATTTGGGGGG + Intergenic
908381533 1:63601613-63601635 AGCCGAGGGCTTCAGTTGGGAGG + Intronic
910417156 1:87013220-87013242 AGAGGTGTGCTACAGTCGTGGGG - Intronic
911063183 1:93764925-93764947 ACATGTGTGCTACAGTGGGGCGG - Intronic
911729697 1:101280037-101280059 AGAGGAGAGCTTGAGTTGGCAGG + Intergenic
911922982 1:103790910-103790932 AGAGGTGAGCGTGAGTTAGGGGG + Intergenic
912777687 1:112516101-112516123 AGAGGTGTGCTTCAGGAAAGAGG - Intronic
913327809 1:117642670-117642692 AGAGGTGTTCTTCAGAAGGCAGG + Intergenic
917629042 1:176875165-176875187 AGAGGTGTTCATCAGTTGACAGG + Intronic
918016812 1:180642718-180642740 AGAGGAGTTCTTAATTTGGGTGG + Intronic
919663409 1:200269777-200269799 AGAGGAGTGATTTAGCTGGGTGG - Intergenic
922272173 1:224043906-224043928 AGAGGTGTGCTTTGGGGGGGAGG - Intergenic
924828891 1:247572177-247572199 AGAGGTGGGCTTCAGAAGGTGGG - Intronic
1063937060 10:11088999-11089021 AGAGGCGAGCTTCTGTAGGGGGG + Intronic
1068061338 10:52071645-52071667 TGAGGTGTGCTTGTCTTGGGTGG + Intronic
1068866582 10:61901784-61901806 AGAGGTGTGGGTGAGCTGGGGGG - Intronic
1073085644 10:100886855-100886877 TGGGGTGTGATTCAGTTGGAGGG - Intergenic
1075209434 10:120478374-120478396 AGAGGTGAGCTTCAGCTATGAGG - Intronic
1075719124 10:124574780-124574802 AGGGGTGTGCTTCAGGATGGCGG - Intronic
1075841520 10:125508672-125508694 ACAGCTGTGCTTCTGTGGGGTGG - Intergenic
1076217137 10:128704004-128704026 AGAGAGATGCTTCAGTTGTGGGG + Intergenic
1077429990 11:2511586-2511608 AGAGCTGGGCTCCTGTTGGGCGG + Intronic
1078105288 11:8354547-8354569 AGACCTGTGCTTGAGCTGGGTGG - Intergenic
1078507444 11:11962964-11962986 AGAGGTGTGCTTCAGTTGGGTGG + Intergenic
1078909678 11:15719314-15719336 AGAGCTGTGCTTCTGTTTGATGG - Intergenic
1081216402 11:40404527-40404549 AGAGGAGCGCTTCACTTGTGAGG - Intronic
1084787644 11:71452927-71452949 AGAGGGGTGCTGCAGCTGGGCGG + Intergenic
1085973763 11:81625826-81625848 ATAGGTGGGCTTCACTTGGCAGG - Intergenic
1086319071 11:85626493-85626515 AAAGTTTTGCTTCAGTTTGGGGG - Intronic
1086934763 11:92732887-92732909 GCAGGTGTGCTTCACTTGGACGG + Intronic
1088101886 11:106165251-106165273 AGAGGTGTGCTGCAGGGGTGGGG - Intergenic
1090267846 11:125364878-125364900 AGATGGGAGCTTCAGCTGGGTGG - Intronic
1090353236 11:126121268-126121290 GGAGGTGGGCTAGAGTTGGGGGG + Intergenic
1091918244 12:4284425-4284447 AGAGGTCTGCTTTGGTTGGAGGG + Intronic
1102566172 12:113798826-113798848 AGATGTGAGCTTCAGGGGGGCGG + Intergenic
1102677688 12:114669273-114669295 CGAGGTGTGTGTCTGTTGGGGGG - Intergenic
1105344664 13:19561415-19561437 AAAGGTGTGCTTAGGTTGGGGGG - Intergenic
1105423316 13:20272242-20272264 AGAGGGCTGATTCAGCTGGGAGG + Intergenic
1105573418 13:21625708-21625730 AGAGTTGTGCTCCAGTGGGTAGG + Intergenic
1107998946 13:45889081-45889103 GCAGCAGTGCTTCAGTTGGGTGG + Intergenic
1108270605 13:48756011-48756033 AGAAGTGTGCTTCAGGGGTGGGG + Intergenic
1113980340 13:114269406-114269428 GGAGGTGTGATTCATTGGGGTGG + Intronic
1115010610 14:28540435-28540457 AGAGGTGTGCTGCAGGGGTGGGG + Intergenic
1116288586 14:43004382-43004404 AGATGTTTTCTACAGTTGGGAGG + Intergenic
1121499066 14:94419217-94419239 AGAGGTGTGCTGCAGGGGTGGGG + Intergenic
1121820925 14:96965319-96965341 AGGGGTGCGACTCAGTTGGGTGG + Intergenic
1122202950 14:100133531-100133553 AGAGGCGTGGATCAGCTGGGAGG - Intronic
1122558070 14:102592216-102592238 AGCGGGGTCCTTCAGATGGGGGG + Intergenic
1124190545 15:27572851-27572873 ATATGTGTGCTGCAGTTGGATGG + Intergenic
1124190552 15:27572897-27572919 ATATGTGTGCTGCAGTTGGATGG + Intergenic
1124190559 15:27572943-27572965 ATATGTGTGCTGCAGTTGGATGG + Intergenic
1126645866 15:50874269-50874291 AGAGGTGCCTTTCAGCTGGGAGG + Intergenic
1129685947 15:77686202-77686224 TGAGGAGGGCCTCAGTTGGGTGG - Intronic
1132150702 15:99456071-99456093 AGAGCTGTGCTCTAGCTGGGAGG + Intergenic
1133023577 16:2977715-2977737 AGAGGGGTGCTGGAGGTGGGAGG - Intronic
1133989893 16:10696534-10696556 AGAGGAGTGCTTGATTTGTGGGG + Intergenic
1136164004 16:28440466-28440488 AGAGGATTGCTTGAGCTGGGAGG + Intergenic
1136198961 16:28674516-28674538 AGAGGATTGCTTGAGCTGGGAGG - Intergenic
1136215308 16:28788690-28788712 AGAGGATTGCTTGAGCTGGGAGG - Intergenic
1136260033 16:29068534-29068556 AGAGGATTGCTTGAGCTGGGAGG - Intergenic
1137792078 16:51183613-51183635 AGAGGATTGCTTGAGCTGGGAGG + Intergenic
1141576082 16:84964229-84964251 TTAGGTGTGCTTCAGGTGTGGGG + Intergenic
1141687977 16:85581194-85581216 AGAAGGGAGCTTCAGTGGGGAGG + Intergenic
1141982272 16:87557892-87557914 AGAGGTGGGCCTCTGTGGGGCGG - Intergenic
1148918207 17:51002665-51002687 GGAGGATTGCTTCAGCTGGGAGG + Intronic
1149493937 17:57105297-57105319 AGAGGTGTGCTCCTCTTGGAGGG + Intronic
1149563709 17:57627340-57627362 AGAGGTGGGCTGCATTTGCGGGG + Intronic
1158635746 18:59155505-59155527 AGATTTGTGCTTCAGTTGAATGG + Intronic
1159131161 18:64281592-64281614 AGAGGTTTGCTGCAGGTGGGAGG + Intergenic
1159157316 18:64601348-64601370 AGAGGTGTGCTGCAGGGGTGGGG - Intergenic
1160515279 18:79476109-79476131 GGAGGTGTGAGTCAGTGGGGAGG + Intronic
1161355064 19:3814486-3814508 AGAGGTGCGTTTCAGGTGGGAGG - Intronic
1161361453 19:3852286-3852308 TGAGGTGGGGTTCAGCTGGGTGG + Intronic
1161361462 19:3852319-3852341 GGAGGTGGGCCTCAGCTGGGTGG + Intronic
1162580056 19:11524008-11524030 GGAGGATTGCTTGAGTTGGGAGG - Intronic
1162730196 19:12713937-12713959 GGAGGATTGCTTCAGCTGGGAGG + Intronic
1162846436 19:13396348-13396370 AGAGCTGTGGATCAGTAGGGAGG - Intronic
1163445957 19:17346674-17346696 TGAGGTCTCCTTCAGTTGGGTGG - Intergenic
1165148722 19:33748963-33748985 AGGGGTGTGCGCCTGTTGGGTGG - Intronic
1165319742 19:35077780-35077802 AGAGGTGTGGTTCACCTGTGGGG - Intergenic
1167283827 19:48587447-48587469 AGGGGTGTGTGTCAGTTGGGAGG + Intronic
925444938 2:3919559-3919581 AGAGCTGTGCTGCAGGTGAGAGG + Intergenic
925444963 2:3919746-3919768 AGAGCTGTGCTGCAGGTGAGAGG + Intergenic
926651667 2:15353143-15353165 TGAGGTGGGCTTTGGTTGGGGGG - Intronic
928407335 2:31024557-31024579 AGAGGTGAGGTTCAGTAGGAGGG - Intronic
928498855 2:31865721-31865743 AGAGGGTTGCCTAAGTTGGGTGG - Exonic
928803755 2:35125796-35125818 GAGGGTGTGCTTCACTTGGGGGG - Intergenic
935178314 2:100668654-100668676 ACAGGTGTGCTTCTGCAGGGGGG - Intergenic
937294076 2:120799251-120799273 AAGGGTGTGCTGCAGTGGGGTGG - Intronic
937840749 2:126521965-126521987 AGAGGAGAGCTACATTTGGGAGG - Intergenic
939989868 2:148867418-148867440 AGAGGTGGGCTTCCCTTGGGAGG - Intergenic
943981061 2:194550960-194550982 AGAAGTGTGCTGGGGTTGGGAGG + Intergenic
948213451 2:236211750-236211772 AGAGTTTTGCTTCGGTTGTGGGG + Intronic
1169484563 20:6017079-6017101 AGAGGACTGCTTGAGCTGGGAGG - Intronic
1169709040 20:8540652-8540674 AGAGGTGTGCTCCAGTGGTTTGG - Intronic
1172029139 20:31969027-31969049 AGGGGTGTGCGTGAGTGGGGAGG + Intronic
1172281343 20:33710284-33710306 AGAGGTGTGGTTCTGTATGGAGG - Intronic
1172999576 20:39095964-39095986 TGAGCTGTGCTGCAGCTGGGTGG + Intergenic
1173713125 20:45177464-45177486 AGAGGTCTATTTCAGTTGAGGGG + Intergenic
1175489597 20:59370925-59370947 TGGGGGGTGCTTCAGATGGGAGG + Intergenic
1177745277 21:25205192-25205214 AGAGGTTTTCTTCTCTTGGGTGG - Intergenic
1179135311 21:38675299-38675321 AGAGGTGTGGTTCAGTTCAGAGG - Intergenic
1179650706 21:42806722-42806744 AGAGGTTTTCTTGGGTTGGGAGG + Intergenic
1179787951 21:43740456-43740478 AGAGGGGTGATTCATGTGGGAGG + Intronic
1179851903 21:44142690-44142712 AGAGTTGTGCTGCAGGTCGGAGG + Intronic
950846755 3:16022633-16022655 AGAGGGGTATTTAAGTTGGGAGG + Intergenic
953779458 3:45853956-45853978 AGAAGTCTGTTTCAGTAGGGAGG - Intronic
954139346 3:48596799-48596821 CAAGGTGTGCTCCAGGTGGGGGG + Intergenic
954861143 3:53691394-53691416 AGAGGTATTCTTCAATTGGGAGG - Intronic
958994292 3:100884644-100884666 AGATGTGTGCTTGAGGTGTGTGG - Intronic
960579936 3:119268060-119268082 ACAGGTGTGCTGCAGTTTGCTGG - Intergenic
960950157 3:122993942-122993964 ACAGGTGGGCTTGAGGTGGGGGG - Intronic
961168760 3:124781010-124781032 AGCTGTGTGCTTCAGTTCGCTGG + Intronic
962449359 3:135499197-135499219 AAACAAGTGCTTCAGTTGGGAGG - Intergenic
966779528 3:183571930-183571952 AGAGGTGACCATCACTTGGGGGG - Intergenic
967138050 3:186529176-186529198 AGAAATGTGCTGCAGTGGGGAGG + Intergenic
967585630 3:191210940-191210962 ATAGATGAGCTTCAGTTGGCTGG + Intronic
969194642 4:5551033-5551055 AGAGGTGTGCTGCAGGGGTGGGG + Intronic
969694972 4:8729288-8729310 AGAGGGGAGCCTCAGGTGGGGGG + Intergenic
972443256 4:39117478-39117500 AGAGGATTGCTTCAGTTGCAAGG + Intronic
974453235 4:62093788-62093810 GGAGGTGTCTTCCAGTTGGGAGG + Intergenic
978763210 4:112377895-112377917 AGAGGTGAGGTTCTGATGGGAGG + Exonic
983437998 4:167740902-167740924 ATAGATATGCTTTAGTTGGGTGG - Intergenic
984454295 4:179945310-179945332 AGAGGTTTGCTGCAGTGGGTGGG + Intergenic
991021369 5:61983269-61983291 AGAGGTGGGGTGCAGGTGGGAGG + Intergenic
992771316 5:80050943-80050965 AGAGGTGTGGTCGAGTCGGGAGG + Intronic
993008064 5:82449477-82449499 GGATGTGTGTATCAGTTGGGTGG + Intergenic
993383912 5:87241008-87241030 AGATGTGTATTTCAGGTGGGTGG - Intergenic
995805809 5:116051256-116051278 AGAGGAGAGCCTCAGTAGGGTGG + Intronic
1000453614 5:161421015-161421037 GGAGGGCTGCTTTAGTTGGGTGG - Intronic
1001785931 5:174413136-174413158 AGAGTTCTGCTTCAATCGGGAGG - Intergenic
1003639356 6:7863545-7863567 AGCAGTGTGCTTCAGGTTGGAGG - Intronic
1004969421 6:20892221-20892243 AGAGGTGTGGAGCAGTAGGGAGG + Intronic
1006195095 6:32235260-32235282 GGAGGGGTGCCTCAGCTGGGTGG + Intergenic
1006264307 6:32904962-32904984 AGAGGAGTGCTCAAGGTGGGAGG + Intergenic
1006502046 6:34465577-34465599 AGGGGTGGGCATCAGTGGGGCGG + Intergenic
1009316660 6:62229036-62229058 AGGGGTGTGCTTCGTTTCGGGGG + Intronic
1009510940 6:64548889-64548911 AGAGATGGGCAACAGTTGGGAGG - Intronic
1011343766 6:86346688-86346710 AGAGGTGTGCTGCAGGGGTGGGG - Intergenic
1012379115 6:98599147-98599169 ACAGGTGTGCTTTGGTTGAGGGG - Intergenic
1014397710 6:120946472-120946494 AGAGGGGAGCTTCATGTGGGTGG - Intergenic
1014407010 6:121064777-121064799 AGAGGTGTGCTTCAGGGGCAGGG + Intergenic
1014868359 6:126559617-126559639 AGAAGTGGGCTTCAGCTGGTGGG + Intergenic
1015297509 6:131614600-131614622 ACAGGTGAGCTCCAGTTGAGAGG + Intronic
1015898945 6:138044936-138044958 AGAGGGGTGCTTGAACTGGGAGG + Intergenic
1017184901 6:151591160-151591182 TCTGGTGTGCTTCAGTTGGCAGG + Intronic
1019565110 7:1675188-1675210 AGAGATGCGCTTCTGTGGGGTGG - Intergenic
1020138910 7:5601868-5601890 AGGGGTGTTCTGCAGTGGGGTGG + Intronic
1022040206 7:26573897-26573919 AGAGATGTGCTTCTGTTTGAAGG - Intergenic
1026300402 7:69092714-69092736 ATAGCTGTGGTTCAGTTGGATGG - Intergenic
1029267080 7:99351042-99351064 AGAGATGTGTTTGAGTTTGGCGG + Intronic
1029551676 7:101239978-101240000 AGGGGTGTGCCTCTGTTGAGGGG - Intronic
1033098153 7:138448677-138448699 AGAGGGGTATTTAAGTTGGGAGG + Intergenic
1039224495 8:35373000-35373022 AGTGGTTTGCTTTAGTTTGGGGG + Intronic
1043256073 8:78138204-78138226 CCAGGAATGCTTCAGTTGGGTGG + Intergenic
1044693417 8:94900256-94900278 AGAGGTGTGCTCTCGGTGGGGGG + Intronic
1046608696 8:116400022-116400044 AGAGGTGTTCCTCAGTGGGCAGG - Intergenic
1049445886 8:142631305-142631327 AGAGGTGGGCTTTCCTTGGGAGG - Intergenic
1050827158 9:9961547-9961569 ATTGGTGTGCTTCATTTTGGAGG + Intronic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1056541930 9:87579136-87579158 AAATGTGTGCATCAGTGGGGAGG - Intronic
1058940527 9:109809037-109809059 AGAGGTGTGCTGCAGGGGTGGGG + Intronic
1060904493 9:127292609-127292631 AGAGTTGTGCTTACGTAGGGTGG - Intronic
1061650515 9:132044650-132044672 AGAGTTGTCCTTCAGATGTGAGG - Intronic
1062121026 9:134834108-134834130 AGAAGTGTGGTGCAGCTGGGAGG + Intronic
1188003230 X:25001222-25001244 AGAGGTTTGCTTAAGGTTGGGGG + Intergenic
1188573558 X:31618442-31618464 AGAGAAGTGTTTCAGTTGGGAGG + Intronic
1190927403 X:54921928-54921950 AGAGGTGGGCCTAAGATGGGGGG + Intronic
1193438611 X:81511819-81511841 AGTGGTGTCCTTCTGGTGGGGGG - Intergenic
1196604799 X:117644958-117644980 AGTGATGTCCTTCAGATGGGAGG - Intergenic
1197069147 X:122272579-122272601 AGAGGTATGCTGCAAGTGGGAGG - Intergenic
1199192069 X:144981942-144981964 AGAGGTGTGCTGCAGGGGTGGGG + Intergenic
1202063049 Y:20908335-20908357 AGGGGTGTCTTTCAGCTGGGAGG + Intergenic