ID: 1078510990

View in Genome Browser
Species Human (GRCh38)
Location 11:11983821-11983843
Sequence TTGTTGTATAGGCATTGGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 319}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078510990_1078510995 22 Left 1078510990 11:11983821-11983843 CCGACCCAATGCCTATACAACAA 0: 1
1: 0
2: 2
3: 18
4: 319
Right 1078510995 11:11983866-11983888 AACCTTCAGTTTCTTCAAAATGG 0: 1
1: 0
2: 2
3: 37
4: 475

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078510990 Original CRISPR TTGTTGTATAGGCATTGGGT CGG (reversed) Intronic
900072842 1:787570-787592 CTGTTTTATAGGATTTGGGTGGG - Intergenic
901349072 1:8576252-8576274 CTTTTCTATAGGCATGGGGTGGG + Intronic
903315423 1:22500683-22500705 TTGTTGTATAAACGTTGGTTAGG + Intronic
903439168 1:23374573-23374595 CCGTTGTATAGGATTTGGGTAGG - Intergenic
906081382 1:43091015-43091037 CTGTTTTATAGGATTTGGGTAGG - Intergenic
906827740 1:48999699-48999721 TTGTGGAATATGGATTGGGTGGG - Intronic
906970551 1:50509110-50509132 TTGTTGTTTAGCCATTGGCTTGG - Intronic
910451524 1:87351468-87351490 TTGTTTTTTTGGCAGTGGGTGGG + Intergenic
912813286 1:112809932-112809954 CTGTTTTATAGGATTTGGGTAGG - Intergenic
912939476 1:114032335-114032357 CTGTTTTATAGGATTTGGGTAGG - Intergenic
912940124 1:114037378-114037400 CTGTTTTATAGGATTTGGGTAGG - Intergenic
913662355 1:121015780-121015802 TTGTTGTAGAGGCAGTGGCCAGG - Intergenic
913702861 1:121390360-121390382 TAGTTGTATTGGCTTTGTGTGGG - Exonic
914013735 1:143798965-143798987 TTGTTGTAGAGGCAGTGGCCAGG - Intergenic
914043424 1:144070864-144070886 TAGTTGTATTGGCTTTGTGTGGG - Intergenic
914134662 1:144889631-144889653 TAGTTGTATTGGCTTTGTGTGGG + Exonic
914164089 1:145162222-145162244 TTGTTGTAGAGGCAGTGGCCAGG + Intergenic
914652358 1:149707574-149707596 TTGTTGTAGAGGCAGTGGCCAGG - Intergenic
916941509 1:169683332-169683354 CTGTTTTATAGGATTTGGGTGGG - Intronic
916942296 1:169688577-169688599 CTGTTTTATAGGATTTGGGTGGG - Intronic
917613901 1:176717175-176717197 TTGTTTTGTAAGCATTGGTTAGG + Intronic
918946160 1:191068221-191068243 TTGGGGTATAGGTATTGGATAGG - Intergenic
919348161 1:196413213-196413235 TTGTTGTAAAGGCAGAGGTTTGG + Intronic
920490292 1:206409101-206409123 TAGTTGTATTGGCTTTGTGTGGG - Intronic
921013746 1:211168545-211168567 TGGGGGTATAGGCATTGGGTAGG + Intergenic
921509745 1:216013722-216013744 CTGTTTTATAGGATTTGGGTAGG - Intronic
922154401 1:223029827-223029849 CTGTTTTATAGGATTTGGGTAGG + Intergenic
922268429 1:224010501-224010523 CTGTTTTATAGGATTTGGGTGGG - Intergenic
922362993 1:224840050-224840072 CTGTTTTATAGGATTTGGGTAGG + Intergenic
922363861 1:224845809-224845831 CTGTTTTATAGGATTTGGGTAGG + Intergenic
923244413 1:232118418-232118440 CTGTTTTATAGGATTTGGGTAGG - Intergenic
923245244 1:232123798-232123820 TCGTTTTATAGGATTTGGGTAGG - Intergenic
923256853 1:232229754-232229776 CTGTTTTATAGGATTTGGGTAGG + Intergenic
923257604 1:232234674-232234696 CTGTTTTATAGGATTTGGGTAGG + Intergenic
923956754 1:239031115-239031137 CTGTTTTATAGGATTTGGGTAGG - Intergenic
924180297 1:241434144-241434166 CTGTTTTATAGGACTTGGGTAGG - Intergenic
1063362774 10:5471031-5471053 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1065610255 10:27465613-27465635 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1065611027 10:27470790-27470812 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1067409837 10:46054679-46054701 TTGCTTTATAGGAGTTGGGTAGG + Intergenic
1067853789 10:49772877-49772899 CTGTTTTATAGGTTTTGGGTGGG + Intergenic
1068681250 10:59822884-59822906 TTTTTTTATAAGCATAGGGTGGG - Intronic
1070894189 10:79967921-79967943 CTGTTTTATAGGATTTGGGTAGG - Intronic
1071008431 10:80910514-80910536 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1071729062 10:88229911-88229933 TTGGTGGATGGGCATTGGGGTGG + Intergenic
1072852577 10:98911682-98911704 TCATTGTTTAGGCATTGAGTAGG + Intronic
1072995070 10:100236402-100236424 TTATTAAATAGGCAATGGGTTGG - Intronic
1074463790 10:113664451-113664473 CTGTTGTAAACGCTTTGGGTAGG - Intergenic
1078046460 11:7917592-7917614 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1078510990 11:11983821-11983843 TTGTTGTATAGGCATTGGGTCGG - Intronic
1079018528 11:16889297-16889319 TTGCTTTATAGGAGTTGGGTAGG - Intronic
1079726616 11:23887385-23887407 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1079889329 11:26030448-26030470 TTGCTTTATAGGAGTTGGGTAGG - Intergenic
1080272350 11:30463965-30463987 TTGTTTTTTAGGTATTGCGTGGG - Intronic
1081299050 11:41427976-41427998 TTGTTTTATAGGATTTGGGTAGG - Intronic
1084231969 11:67759949-67759971 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1084355031 11:68632651-68632673 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1084927153 11:72522890-72522912 TGGTTTTATAGGCACAGGGTTGG + Intergenic
1085946593 11:81280109-81280131 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1090066931 11:123511185-123511207 CTGTTGTATAAGGAATGGGTGGG + Intergenic
1092723261 12:11462294-11462316 CTGTTTTATAGGATTTGGGTAGG + Intronic
1092724061 12:11467696-11467718 CTGTTTTATAGGATTTGGGTAGG + Intronic
1092789376 12:12058636-12058658 CTGTTTTATAGGATTTGGGTAGG - Intronic
1092996824 12:13958776-13958798 TGGTTGTATTGGTAGTGGGTGGG - Intronic
1095274313 12:40261925-40261947 TTGTTATATAGACATTGAGCTGG + Intronic
1097177682 12:57152737-57152759 TTGTTCTCCAGGCATTGGGATGG + Intronic
1097542516 12:60957338-60957360 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1097544294 12:60979399-60979421 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1098140582 12:67446554-67446576 TTGTTTTCAAAGCATTGGGTTGG - Intergenic
1098173186 12:67766931-67766953 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1098173951 12:67772021-67772043 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1099762247 12:86938985-86939007 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1099836385 12:87912615-87912637 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1102117073 12:110410828-110410850 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1102690421 12:114756237-114756259 TTGTTGGATAGGCTGTGGGTAGG - Intergenic
1103041163 12:117696624-117696646 TTCTTGTAAAGGCATTGCATTGG + Intronic
1106016079 13:25870281-25870303 TTTTTGTATAGGCACAGGATAGG + Intronic
1106399571 13:29416255-29416277 TTGTTGTAGAGGCAACAGGTGGG - Intronic
1107219790 13:37969132-37969154 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1108330894 13:49381721-49381743 TTGTGGTATAGGCATTAGTGTGG - Intronic
1108697965 13:52919654-52919676 TTGCTGTGTAGGCATTTTGTAGG + Intergenic
1109945489 13:69426120-69426142 CTGTTTTATAGGATTTGGGTGGG - Intergenic
1110765121 13:79274344-79274366 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1110815748 13:79858362-79858384 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1110845002 13:80183814-80183836 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1111276595 13:85956078-85956100 TTCTTGTCTATGCATTGGGAAGG + Intergenic
1111459219 13:88518418-88518440 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1111631226 13:90848698-90848720 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1112678738 13:101737052-101737074 ATGTTTTATAAGCATTGGGTTGG + Intronic
1114197856 14:20494896-20494918 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1114200030 14:20511484-20511506 TTGTTGTAGAGGCTCAGGGTGGG - Intergenic
1114599060 14:23939701-23939723 TTGCTTTATAGGAGTTGGGTAGG + Intergenic
1116490056 14:45495041-45495063 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1116704401 14:48278594-48278616 CTGTTATATAGGATTTGGGTAGG + Intergenic
1118083852 14:62393588-62393610 TTGTTGTGGTGGCCTTGGGTGGG + Intergenic
1119185380 14:72637891-72637913 TTGTTGTGTCGACATTGGATCGG - Intronic
1121289093 14:92760057-92760079 TTGCTTTATAGGAGTTGGGTAGG - Intergenic
1122040674 14:98985539-98985561 CTGTTTTATAGGACTTGGGTAGG - Intergenic
1122041767 14:98992794-98992816 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1122507364 14:102240175-102240197 TCGTTTTATAGGATTTGGGTAGG - Intronic
1126902303 15:53326925-53326947 TTGTTCTCTAGGCACTGGGCAGG + Intergenic
1129149109 15:73676361-73676383 TTGTTTTAGTGGCAGTGGGTAGG + Intergenic
1129259152 15:74354393-74354415 CTGTTTTATAGGATTTGGGTAGG - Intronic
1130047222 15:80454658-80454680 TTGTTGCAGAAGCTTTGGGTTGG + Intronic
1130835340 15:87644677-87644699 CTGTTGTTTAGCCATTGTGTGGG + Intergenic
1130945441 15:88547393-88547415 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1133962370 16:10505711-10505733 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1134810454 16:17162707-17162729 TTGCTCAATAGGTATTGGGTGGG - Intronic
1135139323 16:19908163-19908185 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1137054434 16:35736549-35736571 TTGCTTTATAGGAGTTGGGTAGG + Intergenic
1140299116 16:73739120-73739142 TAGTTGTCTAGGCATTGGAGAGG - Intergenic
1140576741 16:76179609-76179631 TTGTCATATAACCATTGGGTTGG + Intergenic
1147431336 17:40372572-40372594 TTGCTTTATAGGAGTTGGGTAGG + Intergenic
1149442044 17:56682497-56682519 TTGTTGTATTTGCATGGCGTAGG - Intergenic
1149890519 17:60385256-60385278 CTGTTTTATAGGATTTGGGTGGG - Intronic
1155113246 18:22737280-22737302 TTATTGAATAGGCTGTGGGTGGG - Intergenic
1155739769 18:29273933-29273955 GCTTTGTATAGGCATTAGGTAGG - Intergenic
1155941215 18:31804037-31804059 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1155942090 18:31809911-31809933 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1156354163 18:36327356-36327378 TTATTGTATAGGTATTAGCTTGG + Intronic
1156933425 18:42673225-42673247 TTGTTGTATAGGCAATAGGTAGG + Intergenic
1158119047 18:54028066-54028088 CTGTTGTAGAGGCAATGGGAGGG - Intergenic
1158336012 18:56415739-56415761 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1158336840 18:56421197-56421219 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1159622588 18:70655762-70655784 TTGTAGCATAAACATTGGGTGGG - Intergenic
1162078301 19:8203770-8203792 CTGTTTTATAGGATTTGGGTAGG + Intronic
1162708232 19:12571949-12571971 CTGTTTTATAGGATTTGGGTAGG - Intronic
1163731842 19:18954151-18954173 TGGATGGATAGGCATTGAGTGGG - Intergenic
1164202762 19:23031968-23031990 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1164628307 19:29744210-29744232 TTGAGGTATAAGCATTGGGTGGG - Intergenic
1164749934 19:30645952-30645974 TTGCTGGATAAGCTTTGGGTTGG + Intronic
1165248925 19:34514347-34514369 CTGTTTTATAGGACTTGGGTAGG - Intergenic
1167084051 19:47297013-47297035 CTGTTTTATAGGATTTGGGTAGG - Intronic
1168135438 19:54348075-54348097 TTGCTTTATAGGAGTTGGGTAGG + Intergenic
926186131 2:10692300-10692322 TGGTTGTCTAGGGCTTGGGTGGG - Intergenic
926227725 2:10980199-10980221 TTGTTGAATAGGCATTGAGTTGG + Intergenic
926469249 2:13232552-13232574 TAGTTTAATAGGCTTTGGGTCGG - Intergenic
926961465 2:18362709-18362731 TTATTGTGAAGGCAATGGGTGGG - Intergenic
927133900 2:20082847-20082869 CTGTTTTATAGGATTTGGGTGGG - Intergenic
927134669 2:20087977-20087999 CTGTTTTATAGGATTTGGGTGGG - Intergenic
929050505 2:37832695-37832717 TTTTTGTAAAGGCATTGACTGGG + Intergenic
930272942 2:49277839-49277861 CTGTTTTATAGGATTTGGGTAGG - Intergenic
930429949 2:51263158-51263180 CTGTTTTATAGGATTTGGGTAGG + Intergenic
932363706 2:71131629-71131651 TTGCTTTATAGGAGTTGGGTAGG + Intronic
932659436 2:73639627-73639649 TTGTGTTACAGGTATTGGGTAGG - Intergenic
933589919 2:84221063-84221085 CTGTTTTATAGGATTTGGGTGGG + Intergenic
934607006 2:95703158-95703180 ATGTTGTATAGGCTTTGAGTTGG + Intergenic
936883016 2:117279056-117279078 CTGTTTTATAGGATTTGGGTAGG - Intergenic
936883805 2:117284362-117284384 CTGTTTTATAGGATTTGGGTAGG - Intergenic
939210822 2:139173080-139173102 TTTTTGTATAGGCACTGTGCTGG + Intergenic
941529992 2:166656224-166656246 TTGTTTTATATGCATTGGGATGG + Intergenic
943196571 2:184759869-184759891 CTGTTTTATAGGATTTGGGTAGG - Intronic
943412100 2:187558066-187558088 CTGTTTTATAGGATTTGGGTAGG + Intronic
944516595 2:200518323-200518345 TTGTGATATAGGCAATGGATAGG + Intronic
945394008 2:209299647-209299669 CTGTTTTATAGGATTTGGGTAGG - Intergenic
945554434 2:211262033-211262055 TAGTTTTATAGGATTTGGGTAGG - Intergenic
946101944 2:217332905-217332927 TTGCTTTATAGGAGTTGGGTGGG + Intronic
946120555 2:217509771-217509793 TTGTTGCATAGACAATAGGTGGG - Intronic
947244194 2:228028959-228028981 TTGTTGGGTAGGGAATGGGTGGG + Intronic
1168942743 20:1727363-1727385 CTGTTTTATAGGATTTGGGTGGG + Intergenic
1169661043 20:7978744-7978766 TTGAAGTATAGTCATTGGATGGG - Exonic
1170166225 20:13362542-13362564 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1170984946 20:21249011-21249033 TAGTTGTCTAGGCCTGGGGTCGG + Intergenic
1172719740 20:36990623-36990645 TTGCTTTATAGGAGTTGGGTAGG - Intergenic
1173119342 20:40274614-40274636 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1175586675 20:60146609-60146631 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1175647952 20:60692056-60692078 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1176998649 21:15584937-15584959 TTGTTTTATAAGCATCAGGTAGG + Intergenic
1177080307 21:16631307-16631329 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1179892997 21:44346571-44346593 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1182893005 22:33834537-33834559 CTGTTTTATAGGATTTGGGTAGG - Intronic
951926449 3:27913592-27913614 TTGTTTTATAGGCACTGGATTGG + Intergenic
953131928 3:40148284-40148306 TTGTTGTTTAGGCAATTGGTAGG + Intronic
953598894 3:44344780-44344802 TAGTTTTATAGGATTTGGGTAGG + Intronic
953826040 3:46251733-46251755 CTGTTTTATAGGATTTGGGTAGG + Intronic
953841461 3:46393090-46393112 TGGTTCTATAGGATTTGGGTAGG + Intergenic
954833100 3:53440019-53440041 TTGTTTTTTAGTCACTGGGTTGG + Intergenic
954971747 3:54657023-54657045 CTGTTTTATAGGATTTGGGTAGG + Intronic
955690426 3:61585411-61585433 TGGTACTATAGCCATTGGGTGGG + Intronic
957804131 3:85124777-85124799 TTGTAATATAAGCTTTGGGTTGG - Intronic
958751474 3:98196644-98196666 CTGTTTTATAGGATTTGGGTAGG - Intronic
959485293 3:106922890-106922912 CTGTTTTATAGGATTTGGGTAGG + Intergenic
959486083 3:106928106-106928128 CTGTTTTATAGGATTTGGGTAGG + Intergenic
959688779 3:109176525-109176547 CTGTTTTATAGGATTTGGGTAGG + Intergenic
960477488 3:118146577-118146599 TTGTTTTATAGGAGTTGGGTAGG + Intergenic
960874785 3:122285603-122285625 CTGTTGTCAAGGCATTGGGCAGG - Exonic
961293981 3:125869350-125869372 CTGTTTTATAGGATTTGGGTAGG - Intergenic
962504374 3:136030867-136030889 TTGATTGATGGGCATTGGGTTGG + Intronic
963614229 3:147514889-147514911 TTGTTTTATAAGCATTGTGAAGG + Intergenic
963684798 3:148419950-148419972 TCGTTTTATAGGATTTGGGTAGG - Intergenic
964299685 3:155274562-155274584 TTGTTTTATAAGATTTGGGTAGG + Intergenic
964693513 3:159480921-159480943 CTGTTTTATAGGATTTGGGTAGG + Intronic
965262137 3:166500727-166500749 CTGTTTTATAGGGTTTGGGTAGG + Intergenic
967051250 3:185786589-185786611 CTGTTTTATAGGATTTGGGTGGG - Intronic
967646221 3:191927570-191927592 CTGTTTTATAGGATTTGGGTAGG - Intergenic
970088040 4:12369537-12369559 CTGTTTTATAGGATTTGGGTAGG - Intergenic
970821376 4:20219187-20219209 TTGTTGTCTATGCTTTTGGTGGG + Intergenic
971603186 4:28622623-28622645 TTATTGCATAGGGAGTGGGTAGG - Intergenic
974637129 4:64579758-64579780 CTGTTTTATAGGATTTGGGTAGG - Intergenic
976983928 4:91268674-91268696 CTGTTTTATAGGATTTGGGTGGG + Intronic
977062921 4:92277323-92277345 CTGTTTTATAGGATTTGGGTAGG + Intergenic
978231974 4:106410601-106410623 CTGTTTTATAGGATTTGGGTAGG + Intergenic
980285433 4:130773124-130773146 CTGTTTTATAGGATTTGGGTAGG - Intergenic
980471928 4:133263684-133263706 CTGTTTTATAGGATTTGGGTAGG + Intergenic
980904405 4:138933397-138933419 CTGTTTTATAGGATTTGGGTAGG - Intergenic
981680306 4:147389793-147389815 TTGCTGGATAGGCAGGGGGTTGG - Intergenic
982791351 4:159595266-159595288 TTTTTTTATAGGATTTGGGTGGG - Intergenic
983153690 4:164317768-164317790 TTGTTGTATTGGCTGTGAGTTGG + Intronic
983448527 4:167881876-167881898 CTGTTTTATAGGATTTGGGTAGG - Intergenic
983708027 4:170682189-170682211 CTGTTTTATAGGATTTGGGTAGG - Intergenic
984099366 4:175466807-175466829 CTGTTTTATAGGATTTGGGTAGG + Intergenic
984351183 4:178595950-178595972 TTGTTCTATTGTCATTGTGTAGG + Intergenic
985380738 4:189392095-189392117 TTGCTTTATAGGAGTTGGGTAGG + Intergenic
986081675 5:4400958-4400980 TTGTTGTCAAGACATTAGGTGGG + Intergenic
986193201 5:5515825-5515847 CTGTTTTATAGGATTTGGGTAGG - Intergenic
986193989 5:5521017-5521039 CTGTTTTATAGGATTTGGGTAGG - Intergenic
987282464 5:16425279-16425301 CTGTTTTATAGGATTTGGGTAGG - Intergenic
988008105 5:25445945-25445967 CTGTTTTATAGGATTTGGGTAGG + Intergenic
989279581 5:39625782-39625804 TTGTTTTCTGGGAATTGGGTTGG - Intergenic
989584920 5:43067213-43067235 TTGTCGTAGTGGCACTGGGTGGG - Intronic
990585400 5:57206681-57206703 TTTTTGTATATGGTTTGGGTAGG + Intronic
990743924 5:58938890-58938912 TTGTCGGATAGACATTTGGTTGG + Intergenic
993708824 5:91201799-91201821 TTGTTGTCTTCACATTGGGTAGG - Intergenic
994126397 5:96172097-96172119 CTGTTTTATAGGATTTGGGTAGG + Intergenic
994237834 5:97385554-97385576 TTGTAGTCTAGGCATTTGGTTGG - Intergenic
994776143 5:104037167-104037189 CTGTTTTATAGGATTTGGGTAGG - Intergenic
995548015 5:113252207-113252229 TTGTGGTCTAGGCAATGGGGAGG - Intronic
995624107 5:114057853-114057875 TTCTTTTATATGCATTTGGTTGG + Intergenic
997770011 5:136545093-136545115 CTGTTTTATAGGATTTGGGTAGG + Intergenic
998633277 5:143925084-143925106 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1001175444 5:169464219-169464241 TTGTTGTAGATTCAATGGGTTGG - Intergenic
1001330993 5:170762206-170762228 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1004824792 6:19407348-19407370 TTTCTGAATATGCATTGGGTGGG + Intergenic
1005027577 6:21478141-21478163 TTTGTGTTTATGCATTGGGTGGG - Intergenic
1007012766 6:38433585-38433607 CTGTTTTATAGGATTTGGGTGGG - Intronic
1007084184 6:39131640-39131662 CTGTTTTATAGGATTTGGGTGGG + Intergenic
1007300109 6:40861522-40861544 CTGTTTTATAGGATTTGGGTGGG + Intergenic
1008089407 6:47278279-47278301 TTGTTTTAAAGACATTGGATTGG - Intronic
1009217048 6:60934695-60934717 TCTTTGTATAGGCAGAGGGTGGG + Intergenic
1009344052 6:62591582-62591604 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1009464082 6:63950445-63950467 CTGTTTTATAGGATTTGGGTAGG - Intronic
1009465297 6:63961479-63961501 CTGTTTTATAGGATTTGGGTGGG - Intronic
1011426318 6:87235393-87235415 TTTCTGTATAAGCATTGGGGGGG + Intronic
1012225242 6:96695840-96695862 TTGATTGATAGGCATTTGGTTGG - Intergenic
1012985225 6:105868393-105868415 TTGTTGTAAGGGAATTGGGATGG + Intergenic
1013208517 6:107966158-107966180 TTGTTGTGGAGGCTGTGGGTTGG - Intergenic
1014455234 6:121625975-121625997 CTGTTTTATAGGATTTGGGTGGG + Intergenic
1014614998 6:123587731-123587753 CTGTTTTATAGGATTTGGGTAGG + Intronic
1015269315 6:131323599-131323621 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1015271021 6:131339103-131339125 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1016205301 6:141460535-141460557 CCGTTTTATAGGCTTTGGGTAGG - Intergenic
1016750960 6:147630603-147630625 CTGTTTTATAGGATTTGGGTGGG - Intronic
1017559169 6:155608078-155608100 TTTTGGTATAGGCATGGGGAAGG - Intergenic
1020254005 7:6491593-6491615 TTGTAGAAGAGGCATGGGGTGGG + Intergenic
1020542101 7:9470909-9470931 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1020579114 7:9971842-9971864 TGGGGGTACAGGCATTGGGTAGG - Intergenic
1020897216 7:13955509-13955531 TTGTTGTATTGGCAATGGCTGGG - Intronic
1021172405 7:17414348-17414370 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1021345777 7:19526321-19526343 TTGTTGCATAGGCATTGGAAAGG - Intergenic
1021779443 7:24088092-24088114 TTGATTGATGGGCATTGGGTTGG + Intergenic
1022455847 7:30557693-30557715 TTGTTGTATGAGCAATGGATGGG + Intergenic
1022841233 7:34165810-34165832 TAGGTGTATTGGCATTGGGTTGG + Intergenic
1023095965 7:36660113-36660135 TTGCTTTATAGGAGTTGGGTAGG - Intronic
1023635375 7:42204231-42204253 TTGTTGGATAGGCATGGTTTGGG - Intronic
1023732196 7:43202950-43202972 CTGTTTTATAGGATTTGGGTAGG - Intronic
1026004939 7:66592948-66592970 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1027157481 7:75779163-75779185 CTGTTTTATAGGATTTGGGTAGG - Intronic
1027471293 7:78577603-78577625 CTGTTTTATAGGATTTGGGTAGG + Intronic
1027951586 7:84823424-84823446 TTGTTTTATAGGAGTTGGATAGG - Intergenic
1029735293 7:102462290-102462312 TTGTTCCATAGCCATCGGGTTGG + Intronic
1030445287 7:109641834-109641856 CTGTTTTATAGGATTTGGGTGGG + Intergenic
1031354664 7:120776748-120776770 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1031421942 7:121563772-121563794 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1032724585 7:134578921-134578943 TTCTGGTGTAGGCAATGGGTTGG + Intronic
1034333816 7:150307558-150307580 TTGCTTTATAGGAGTTGGGTAGG - Intronic
1034674829 7:152884851-152884873 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1036281137 8:7402593-7402615 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1036340329 8:7908979-7909001 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1036393275 8:8344256-8344278 TTGTGGTATAGTCTTTTGGTGGG + Intronic
1038477342 8:27877465-27877487 TTGGTGAAAAGGCAGTGGGTGGG - Intronic
1041090229 8:54295077-54295099 TTGTTGTATTCTCATGGGGTGGG - Intergenic
1041270888 8:56107615-56107637 CTGTTTTATAGGATTTGGGTGGG - Intergenic
1042705809 8:71664881-71664903 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1042706629 8:71670302-71670324 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1042707054 8:71675240-71675262 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1043604452 8:81983173-81983195 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1043718238 8:83510646-83510668 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1045252845 8:100495887-100495909 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1045881064 8:107041431-107041453 TTGTTGAATAGGCAATGTATGGG + Intergenic
1046263813 8:111805502-111805524 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1046293795 8:112196128-112196150 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1047995297 8:130329289-130329311 TTGTGGAACAGACATTGGGTGGG + Intronic
1048712530 8:137228056-137228078 TTGTTTTATAGGAGTTGGGTAGG - Intergenic
1050257570 9:3811026-3811048 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1050258412 9:3816492-3816514 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1050895797 9:10885236-10885258 TTGTTTTATAAGATTTGGGTAGG - Intergenic
1052192374 9:25675070-25675092 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1054806971 9:69404710-69404732 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1055233541 9:74091264-74091286 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1055946253 9:81693923-81693945 ATGTTTAATAGGCATTTGGTTGG + Intergenic
1056522060 9:87410999-87411021 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1057234510 9:93347891-93347913 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1057362561 9:94388312-94388334 TTGTTATATACTCCTTGGGTGGG + Intronic
1057660775 9:96999778-96999800 TTGTTATATACTCCTTGGGTGGG - Intronic
1059862997 9:118485758-118485780 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1060778735 9:126395995-126396017 GTGCTGTATAGCCATGGGGTTGG + Intronic
1186080380 X:5924597-5924619 TTGATTGATGGGCATTGGGTTGG - Intronic
1186440981 X:9586506-9586528 TTGTTGAATGGGCATAGAGTTGG + Intronic
1187745506 X:22404666-22404688 TTGCTTTATAGGAGTTGGGTAGG - Intergenic
1188300583 X:28502714-28502736 CTGTTTTATAGGATTTGGGTGGG + Intergenic
1189032087 X:37460985-37461007 CTGTTTTATAGGATTTGGGTGGG + Intronic
1191826113 X:65365865-65365887 TCGTTTTATAGGATTTGGGTAGG - Intergenic
1193423319 X:81310801-81310823 TTGATTGATGGGCATTGGGTTGG + Intergenic
1194186592 X:90778832-90778854 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1194366774 X:93023221-93023243 TCGTTTTATAGGATTTGGGTAGG - Intergenic
1194373913 X:93109679-93109701 TGGTGGTACAGGCATTGAGTAGG + Intergenic
1194421793 X:93684170-93684192 TTGTTGTATAGGCAGAGAGGTGG + Intronic
1194502503 X:94698945-94698967 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1194503326 X:94704302-94704324 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1194503400 X:94704764-94704786 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1195438066 X:104868004-104868026 TTATTGTAAAGGCACTAGGTAGG + Intronic
1195841135 X:109178647-109178669 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1196341235 X:114601397-114601419 CTGTTTTATAGGATTTGGGTAGG + Intronic
1196470150 X:116014688-116014710 TTGCTTTATAGGAGTTGGGTAGG - Intergenic
1196862624 X:120042040-120042062 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1196880478 X:120194304-120194326 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1196963991 X:121035691-121035713 TACTTGTATTGGCATTAGGTAGG + Intergenic
1197554990 X:127942096-127942118 TTTTTGTAGAGGCTGTGGGTGGG - Intergenic
1198180765 X:134206336-134206358 TAGTTGTTTAGGCACTGTGTAGG + Intergenic
1198258581 X:134946585-134946607 CTGTTTTATAGGATTTGGGTAGG - Intergenic
1198559992 X:137839221-137839243 TTTTGGTATAGGCATTCAGTGGG - Intergenic
1198748367 X:139913698-139913720 CTGTTTTATAGGATTTGGGTAGG - Intronic
1198983239 X:142423501-142423523 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1200533194 Y:4360908-4360930 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1200674997 Y:6139477-6139499 TTGTTTTATAGGATTTGGGTAGG - Intergenic
1200681942 Y:6223750-6223772 TGGTGGTACAGGCATTGAGTAGG + Intergenic
1201234521 Y:11896434-11896456 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1201303895 Y:12534403-12534425 CTGTTTTATAGGATTTGGGTGGG - Intergenic
1201306956 Y:12559335-12559357 CTGTTTTATAGGATTTGGGTAGG + Intergenic
1201473786 Y:14359761-14359783 TTGTTTTATAGGATTTGGGTAGG + Intergenic