ID: 1078512577

View in Genome Browser
Species Human (GRCh38)
Location 11:11996683-11996705
Sequence AGCAGGCATCAAGACAACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078512571_1078512577 5 Left 1078512571 11:11996655-11996677 CCCAATATGCTCATATCCTGAGG 0: 1
1: 1
2: 8
3: 187
4: 1116
Right 1078512577 11:11996683-11996705 AGCAGGCATCAAGACAACCTTGG 0: 1
1: 0
2: 0
3: 9
4: 165
1078512573_1078512577 4 Left 1078512573 11:11996656-11996678 CCAATATGCTCATATCCTGAGGG 0: 1
1: 0
2: 1
3: 6
4: 79
Right 1078512577 11:11996683-11996705 AGCAGGCATCAAGACAACCTTGG 0: 1
1: 0
2: 0
3: 9
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078512577 Original CRISPR AGCAGGCATCAAGACAACCT TGG Intronic
901570476 1:10156048-10156070 AGAAGGCAGCAAGAATACCTGGG + Intronic
903194329 1:21673578-21673600 AGCAGGCAACAATCCAACCCAGG + Intergenic
904558507 1:31381198-31381220 AGGAGGCATAAAGACCACCAAGG + Intergenic
904931327 1:34089669-34089691 AGCAGGAATGAAGACAGCATGGG - Intronic
908692537 1:66798781-66798803 AGCAGGCACCATGAAAAACTAGG + Intronic
911487538 1:98520853-98520875 AGCATGCATCATGACCAACTGGG + Intergenic
913560898 1:120018414-120018436 AGCAAGCATCATTACATCCTTGG - Intronic
913637230 1:120775188-120775210 AGCAAGCATCATTACATCCTTGG + Intergenic
914542528 1:148628762-148628784 AGCAAGCATCATTACATCCTTGG - Intronic
914624105 1:149442482-149442504 AGCAAGCATCATTACATCCTTGG + Intergenic
914952468 1:152128722-152128744 AGAAGGTAACAAAACAACCTTGG - Intergenic
916648100 1:166808676-166808698 GGAAGACAACAAGACAACCTGGG + Intergenic
918508950 1:185289270-185289292 AGCCAACATGAAGACAACCTTGG + Intronic
919633001 1:199977218-199977240 AGCAGGGAACTAGACAAACTAGG - Intergenic
923498872 1:234548223-234548245 AGCAGGCCTAAAGTCAAACTGGG + Intergenic
1067176751 10:43955418-43955440 AGCAGGCATCAGAATCACCTGGG + Intergenic
1067732490 10:48822058-48822080 AGCAGGCATCATGATGACCAGGG - Intronic
1067836508 10:49644841-49644863 AGCAGGCATTGAGAAGACCTAGG + Intronic
1068037871 10:51783618-51783640 AGCATTCATCAACACCACCTGGG + Intronic
1070953141 10:80446755-80446777 AGGAGGCAGGAAGACAAGCTGGG - Intergenic
1070976631 10:80610538-80610560 ACCAAGCATTAAGACCACCTGGG - Intronic
1072332605 10:94368374-94368396 AGCAGGCTTCAACACAAACTGGG - Intergenic
1074199869 10:111225197-111225219 AGAAGGAATCTAGAGAACCTAGG - Intergenic
1074301998 10:112241492-112241514 AACAGGCATCAAGACCATCCAGG - Intergenic
1075705802 10:124499691-124499713 AGGAGGCAGCAGGACAGCCTGGG - Intronic
1075830829 10:125409353-125409375 AGCAGGAAGCCACACAACCTGGG + Intergenic
1077728559 11:4703188-4703210 ACCAGACAACCAGACAACCTTGG - Intergenic
1078512577 11:11996683-11996705 AGCAGGCATCAAGACAACCTTGG + Intronic
1082954724 11:58857610-58857632 ATAAGACATCAACACAACCTGGG - Intronic
1082971782 11:59030307-59030329 ATAAGACATCAACACAACCTAGG - Intronic
1084248896 11:67880589-67880611 TGCTGGCACCAAGAAAACCTTGG + Intergenic
1084452533 11:69248297-69248319 AGCAGCCAGCAAGACAGTCTGGG + Intergenic
1084770721 11:71341403-71341425 AGCAGGCAGCACGAGCACCTGGG - Intergenic
1086474036 11:87151062-87151084 AACAGGAATCAAAACAACCCGGG - Intronic
1087265081 11:96051744-96051766 AGGAGGCATCAGGAGAACCAGGG + Intronic
1089049786 11:115536255-115536277 AGCAGGCAGGAAGACACCTTTGG - Intergenic
1091099311 11:132855498-132855520 AGCAGGCATGAAGACCACTCTGG + Intronic
1091371836 11:135066826-135066848 TGCAGGCAACAAGACAATCAAGG - Intergenic
1097243416 12:57591573-57591595 GGCAGGGACCAAGACAACCCGGG - Intronic
1097583660 12:61489333-61489355 GGCAGGCATCAAAACATGCTAGG - Intergenic
1099450344 12:82800383-82800405 AGCAGGAATCATGACAGCGTAGG - Intronic
1102262677 12:111454055-111454077 AGCAGGCAACAAGTGAGCCTGGG + Intronic
1103808986 12:123598847-123598869 AGCAGAGATCAAGCCAACCTGGG - Intergenic
1103991028 12:124799618-124799640 AGCAGCCACCAAGACCAACTGGG + Intronic
1105235777 13:18551949-18551971 AGCAGCCATGAAATCAACCTAGG - Intergenic
1109305596 13:60637462-60637484 AGCTGACAGCAAAACAACCTAGG + Intergenic
1112163680 13:96895389-96895411 AGCAGGCAGCAAGAACCCCTTGG - Intergenic
1112329995 13:98469767-98469789 AGCAGGCAGGAAGACCACTTGGG - Intronic
1112348245 13:98610985-98611007 TGCAGTCATCAAGACAATGTGGG - Intergenic
1118538847 14:66801234-66801256 TGCAAGTATCAAGACAACCCAGG - Intronic
1202878557 14_KI270722v1_random:34377-34399 GGCTGGCATCAAAATAACCTGGG + Intergenic
1125830884 15:42716417-42716439 AACAGGGATCAAAACAACCAGGG - Intronic
1127392410 15:58517243-58517265 AGCTGGCACCAAAACAACATTGG - Intronic
1128490980 15:68144066-68144088 AGCAGTCATCAAGATACCCTTGG - Intronic
1129434584 15:75528221-75528243 AGCAGGCATCTTGCCAGCCTGGG - Intronic
1131112733 15:89775880-89775902 ATAAGGCATCAAGACAAGCCCGG - Intronic
1132389510 15:101428144-101428166 AGAAGGCACCAAGTCAGCCTGGG + Intronic
1132988800 16:2782648-2782670 AGCGGGCATAACGACCACCTTGG + Intergenic
1135985733 16:27182549-27182571 AGCAGACATCACAACAATCTGGG + Intergenic
1138178222 16:54922986-54923008 AGTAAGCAGCAAGCCAACCTAGG + Intergenic
1141549803 16:84798335-84798357 TGCAGGCAACATGAAAACCTAGG + Intergenic
1141551368 16:84808824-84808846 GGCAGGCACCAAGACGACCAGGG - Intergenic
1144672807 17:17142485-17142507 AGCACGTGTCTAGACAACCTCGG + Intronic
1144789147 17:17847878-17847900 GGCAGGCATGAAGCCCACCTAGG + Intronic
1150130295 17:62665597-62665619 GACAGGCATTAAGACAACATGGG - Intronic
1150917129 17:69448488-69448510 AGCAAGCAGCAAGACAGCCATGG - Intronic
1151931198 17:77232721-77232743 AGCAGGCATCAAAAAAAAATTGG - Intergenic
1153228345 18:2914355-2914377 AGCAGGGATCAAGTTAGCCTGGG - Exonic
1153861027 18:9206447-9206469 AGCAGTCAACAAGACTATCTGGG - Intronic
1154513763 18:15138049-15138071 AGCAGCCATGAAATCAACCTAGG + Intergenic
1155205772 18:23556705-23556727 GGCAGGAATCAAGCCCACCTGGG + Intronic
1160871357 19:1279299-1279321 AGCAGGGCTCAAGCCAGCCTCGG + Intergenic
1165408772 19:35645685-35645707 AGCAGGGACCAAGACAGCCCTGG + Intergenic
1165958117 19:39514860-39514882 AGCAGGCATCAGGAAAGCCCTGG - Intergenic
1202654176 1_KI270708v1_random:3425-3447 GGCTGGCATCAAAATAACCTGGG + Intergenic
926229407 2:10991223-10991245 ATGAGGCATCAAGAAAACCCAGG + Intergenic
930278831 2:49345281-49345303 AGCTGGCTTCAACACATCCTTGG + Intergenic
930346060 2:50182623-50182645 AGCAGGTTTTAAGACAACCAGGG - Intronic
930406079 2:50957211-50957233 AGCAGACATCAAGATAAACCTGG + Intronic
932943328 2:76195798-76195820 ATAAGACAGCAAGACAACCTGGG - Intergenic
935863477 2:107359788-107359810 AGCATGCATCAATTAAACCTTGG - Intergenic
936934043 2:117820645-117820667 AGAAGGCATCAAAATCACCTGGG - Intronic
938176763 2:129140461-129140483 AGCAACCATCAAGACAAACTAGG - Intergenic
938369505 2:130760486-130760508 AGCAGGCATGAACATGACCTGGG - Intronic
938514006 2:131982660-131982682 AGCAGCCATGAAATCAACCTAGG + Intergenic
938577164 2:132615513-132615535 AGCTGGCATTAACACAACCCAGG - Intronic
938738168 2:134205296-134205318 AGCAGGCAGGAAGACGAGCTAGG + Intronic
939556112 2:143675573-143675595 AGCAGGCATGAAAGCAACATTGG + Intronic
945143839 2:206715434-206715456 AGCAAGCAACAAGACAACACTGG - Intronic
948362236 2:237430556-237430578 AACAGGAATCAAGACCACATGGG + Intergenic
948548053 2:238746427-238746449 AGCAGGCAGCAAAACAGCCAGGG - Intergenic
1169775044 20:9242868-9242890 AGCACGCATCAACATCACCTGGG - Intronic
1170282876 20:14670842-14670864 AGCAGCCATCTAGTCAACATGGG - Intronic
1171382434 20:24743759-24743781 AGCAAGCATCAGGATCACCTGGG - Intergenic
1172517950 20:35548680-35548702 AGGAGGGATCAAGACAAGATAGG + Intronic
1173352849 20:42260938-42260960 GGCAGACCTCAAGAAAACCTTGG - Intronic
1174884144 20:54313203-54313225 AGCAGGGACCAAGACAGCCAAGG - Intergenic
1175509757 20:59515879-59515901 AGCAGGCAGCAGCACAGCCTAGG - Intergenic
1176779778 21:13180235-13180257 AGCAGCCATGAAATCAACCTAGG - Intergenic
1177977424 21:27869270-27869292 AGCAGCCATGAAATCAACCTAGG - Intergenic
1178043113 21:28663284-28663306 AGCAGCCATCCAGCCAGCCTGGG + Intergenic
1178536343 21:33413285-33413307 AGCAGGCCTCATGACATCCTGGG - Intronic
1180389322 22:12211008-12211030 GGCTGGCATCAAAATAACCTGGG - Intergenic
1180416617 22:12723468-12723490 GGCTGGCATCAAAATAACCTGGG + Intergenic
1180831279 22:18907639-18907661 AGAATGCCTCCAGACAACCTGGG + Intronic
1181068573 22:20318734-20318756 AGAATGCCTCCAGACAACCTGGG - Intronic
1181615273 22:24049930-24049952 GGCAGGCATCAGGACAGTCTGGG - Intronic
1203281366 22_KI270734v1_random:132910-132932 AGAATGCCTCCAGACAACCTGGG + Intergenic
952935162 3:38391930-38391952 AGCAGGCATGGAGACAAACATGG - Intronic
953411373 3:42692217-42692239 TTCATGGATCAAGACAACCTAGG - Exonic
954149797 3:48651686-48651708 GGCAGGCATCCACACAGCCTGGG + Exonic
957541051 3:81569576-81569598 AGCAGGCTTCCAAAGAACCTGGG + Intronic
959681258 3:109099202-109099224 AGAAGGTATCAAGACATTCTGGG - Intronic
960682629 3:120264911-120264933 AGCAGGCAGCAAGCCAACATGGG + Intronic
965235396 3:166112574-166112596 AGCATGAATCAAGAGAAACTTGG + Intergenic
970703091 4:18766226-18766248 AGCAGACATGAAATCAACCTAGG - Intergenic
973331581 4:48914896-48914918 AGCAGGGACCCAGACTACCTGGG + Intergenic
976101761 4:81571795-81571817 AGCTGGCATCAAAATCACCTGGG + Intronic
976886311 4:89989120-89989142 CGCAAGCATCAAGACCACCGAGG - Intergenic
977668479 4:99668671-99668693 AGCAGGCCTGAAGCCAAACTAGG - Intergenic
977921313 4:102646371-102646393 AGCAGGTATCATCAAAACCTGGG + Intronic
981995073 4:150965237-150965259 AACAGGGGTCAAGACAACCATGG + Intronic
983542297 4:168924943-168924965 AGCATGCACCAGGACAACCACGG + Exonic
984503718 4:180590551-180590573 TGCTGGAGTCAAGACAACCTGGG - Intergenic
986150280 5:5121980-5122002 AGCAGTGATCAAGACATTCTAGG + Intergenic
987342750 5:16953163-16953185 AGCAGGCAGAAAGGAAACCTTGG - Intergenic
990623650 5:57587735-57587757 AAAAGACATCAAGAAAACCTAGG + Intergenic
991925942 5:71705032-71705054 AACAGGAATCATGACAGCCTTGG + Intergenic
995538004 5:113156750-113156772 AGCAGGGCTCAAAACAGCCTAGG - Intronic
999404034 5:151291190-151291212 ACCAGGTGTCAAGACAGCCTAGG - Intronic
1000373584 5:160559677-160559699 TGCAGGGACCAAGACCACCTGGG - Intergenic
1000377863 5:160600488-160600510 AGCAGGAATCAAGCCAATCATGG - Intronic
1001496682 5:172192843-172192865 GGCAGGCATCAAGACCACCCTGG + Intergenic
1001540930 5:172538454-172538476 TGCAGTAATCAAGACAACGTGGG - Intergenic
1005873436 6:29994441-29994463 AGGAGGCACCAAGAAAGCCTGGG - Intergenic
1006037205 6:31223067-31223089 AGGAGGCACCAAGAGAGCCTGGG + Intergenic
1006075543 6:31529900-31529922 AGGAGGCACCAAGAGAGCCTTGG + Exonic
1007951819 6:45879547-45879569 AGCAGGCTTCAGGACAGCCTGGG - Intergenic
1009965907 6:70577733-70577755 AGAAGGCAACAATACAAACTGGG - Intronic
1010755686 6:79663934-79663956 AGCAGGGAGCAAGACTACCAGGG + Intronic
1011102775 6:83743186-83743208 AACAAGCATCAGGACAATCTAGG - Intergenic
1011343382 6:86341560-86341582 CACAAGCATCAAGACCACCTGGG + Intergenic
1012544034 6:100396023-100396045 AGGAGACATCAAGGCATCCTGGG + Intronic
1012710841 6:102602332-102602354 GGCAGGGAACAACACAACCTAGG + Intergenic
1013970208 6:116008799-116008821 AGAAGGGATCAAGATATCCTAGG + Intronic
1014076058 6:117235691-117235713 ATCAAGCATGAAGACAATCTTGG - Intergenic
1016547925 6:145245168-145245190 AGCAGGCTTGAAGAAAATCTTGG + Intergenic
1018716009 6:166533269-166533291 ACCACTCATCAAGTCAACCTAGG - Intronic
1023090091 7:36609269-36609291 ATCAGGCAGCAAGACCAGCTAGG - Intronic
1024208610 7:47184838-47184860 AGGAGGCATCTAGAACACCTGGG + Intergenic
1029904637 7:104079147-104079169 AGCAGGAATTGAGACAACTTGGG - Intergenic
1030326419 7:108223594-108223616 AGCAAGCATCAAGAAAAATTTGG - Intronic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1033397719 7:140991857-140991879 TGCAGGCATCCAGATGACCTGGG - Intergenic
1033489079 7:141824161-141824183 AGCAAGTATCAAGACTACCCAGG - Intergenic
1034212987 7:149381399-149381421 GCCAGGCATCAAGACAACTGGGG - Intergenic
1034954673 7:155327098-155327120 AGCAGGCACCAAGACAGCAGGGG + Intergenic
1036091430 8:5669793-5669815 AGCAGGCATCATGACAAATCTGG - Intergenic
1041613387 8:59877131-59877153 CACAGGCATCAAGACCATCTAGG + Intergenic
1042422088 8:68603011-68603033 AGCAGGCAATAAGAAAACCCAGG + Intronic
1044026083 8:87174611-87174633 AACAGGCATCAAGACCATCCAGG - Intronic
1044202663 8:89454467-89454489 AGCAGTCATCAATACCAGCTAGG + Intergenic
1045440329 8:102202465-102202487 AGAATTCATCAAGACAATCTTGG - Intergenic
1052394151 9:27917305-27917327 AGCTGGCATCATGGCAAACTGGG + Intergenic
1060211941 9:121715970-121715992 ACCAGGCACCAAGACAAAGTGGG - Intronic
1060931090 9:127489967-127489989 AGCAGGCGTCAGGACCACCGTGG - Intronic
1061304110 9:129722779-129722801 AGCAGGCATGGAGACCGCCTCGG + Intergenic
1186340670 X:8642836-8642858 AGCCTGCATCAAGATCACCTGGG - Intronic
1187827664 X:23348060-23348082 AGTAGACATCAAGACCACATGGG + Intronic
1188047207 X:25439652-25439674 AGCAGACATGTAGACAATCTGGG - Intergenic
1197797974 X:130318377-130318399 AGCAGACATCAAGAAAACATAGG - Intergenic
1198377450 X:136053707-136053729 AGCAGGTATACAGATAACCTTGG + Intergenic
1201169898 Y:11248246-11248268 GGCTGGCATCAAAATAACCTGGG - Intergenic
1201864506 Y:18634887-18634909 AGCAGGCAGGAAAAAAACCTTGG - Intergenic
1201868816 Y:18685491-18685513 AGCAGGCAGGAAAAAAACCTTGG + Intergenic