ID: 1078514175

View in Genome Browser
Species Human (GRCh38)
Location 11:12008749-12008771
Sequence TGTAGGGGAGCTGCGTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078514175_1078514187 29 Left 1078514175 11:12008749-12008771 CCTGAAAACGCAGCTCCCCTACA 0: 1
1: 0
2: 1
3: 9
4: 101
Right 1078514187 11:12008801-12008823 GCCCGAGCCCCGATCGCCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078514175 Original CRISPR TGTAGGGGAGCTGCGTTTTC AGG (reversed) Intronic
909691255 1:78410011-78410033 TGTAGGGCAGCTGGCTTTGCTGG - Intronic
910180818 1:84480531-84480553 GGAATGGGAGCTGAGTTTTCAGG - Intronic
916303075 1:163297381-163297403 TGTAGGAGAGCTATGTTTTCTGG + Intronic
918862422 1:189848028-189848050 TGTAAGATAGCTGCGCTTTCTGG + Intergenic
920080987 1:203372847-203372869 TGTAGGGTAGCTGTGTTCCCAGG - Intergenic
922540258 1:226413863-226413885 TGGAGAGCAGCAGCGTTTTCAGG + Intergenic
923231021 1:231986338-231986360 TGTAGGGGAACTGATTTTTAGGG + Intronic
923361010 1:233211118-233211140 TGTAAGGGAGCTGGGGTGTCTGG + Intronic
1070461822 10:76677939-76677961 TGTAGAGTAGCTGCATTTACTGG + Intergenic
1070513277 10:77180175-77180197 TGGAAGGGTGCTGCCTTTTCTGG - Intronic
1075780044 10:125011610-125011632 TGCAGATGAGCTTCGTTTTCAGG - Intronic
1078514175 11:12008749-12008771 TGTAGGGGAGCTGCGTTTTCAGG - Intronic
1078604837 11:12765945-12765967 AGAAAGGGAGCTGCATTTTCAGG - Intronic
1080384680 11:31804393-31804415 TCGAGGGGAGCCGCGTTTTCAGG + Intronic
1085728888 11:78979353-78979375 TGTAGGGGAATTGCATATTCCGG - Intronic
1086944172 11:92828743-92828765 TGTTGGAGTGCTGCGTTTACAGG - Intronic
1088807008 11:113361548-113361570 GGCAGTGGAGCTGCGTTTGCTGG + Intronic
1090443529 11:126744305-126744327 AGCAGGGGAGCAGCCTTTTCTGG + Intronic
1090646516 11:128770905-128770927 TTTAGAGGAGCTCCGCTTTCTGG + Intronic
1092053926 12:5493470-5493492 TGTGGCAGAGCTGCGTTTTGTGG + Intronic
1092904293 12:13088021-13088043 TGTAGGTGATCTGCGTTCCCAGG + Exonic
1102606422 12:114071163-114071185 TGTATGGGGGCTGAGGTTTCAGG + Intergenic
1102641233 12:114368665-114368687 TTTAGGGGAGCAGGGTTTTGGGG + Intronic
1103933606 12:124463606-124463628 GGCAGGGAAGCTGCGTTTTCCGG + Intronic
1105923957 13:24989410-24989432 TGTAAGGGATGAGCGTTTTCAGG - Intergenic
1106001268 13:25725531-25725553 TGTAAGTGAGCTGGGTCTTCTGG + Intronic
1108502746 13:51083485-51083507 TGAAGGGGAGCTGAGTTTTGGGG + Intergenic
1108583148 13:51844813-51844835 TCTAAGGGAGATGGGTTTTCTGG - Intergenic
1108641873 13:52390326-52390348 TGTAGGGCAGATGCATTCTCAGG + Intronic
1108641918 13:52391025-52391047 TGTAGGGCAGATGCATTCTCAGG - Intronic
1109279530 13:60339841-60339863 TCTAGGGGAGGTGAGTTATCAGG + Intergenic
1112086595 13:96038753-96038775 TGTAGGGGAGGTGGATTTTGGGG - Intronic
1116349305 14:43839081-43839103 TTTAGGGGAGCTGTGTTTTGGGG - Intergenic
1122804524 14:104249859-104249881 TGCTGGGGAGCTGCGGTGTCCGG + Intergenic
1123664630 15:22598656-22598678 TCTAGGGGTGCTGGGATTTCAGG + Intergenic
1124241733 15:28033914-28033936 TCTAGGGGAGCTGAGTGTTACGG + Intronic
1124318464 15:28693104-28693126 TCTAGGGGTGCTGGGATTTCAGG + Intergenic
1125364139 15:38895936-38895958 TGTAGGGCAGCCGCCTTTGCTGG - Intergenic
1125690368 15:41591241-41591263 GGTATGGGAGCTGAGGTTTCAGG + Intergenic
1127687599 15:61364374-61364396 TGTAGGGCTGCTGCGTTTGCTGG + Intergenic
1134000873 16:10781814-10781836 TGAAGGAGGGCTGCGTGTTCTGG - Intronic
1135505252 16:23030889-23030911 TGTGGGGGATCTGCGTGTGCAGG - Intergenic
1139297926 16:65919131-65919153 TGCAGGGGAGCTGCATCTCCCGG - Intergenic
1143504622 17:7356806-7356828 TGTGGGGGATCTGGGTTTTTGGG - Exonic
1147455245 17:40533720-40533742 TGGAGGGGAGCTGCATGTGCTGG + Intergenic
1147792878 17:43024572-43024594 TTTGGGGGAGCTGCGTCCTCTGG - Intronic
1148381852 17:47205580-47205602 TGGAGGAGAGCTGTGGTTTCAGG - Intronic
1149272629 17:54997362-54997384 TGTATAGAAGCTGCATTTTCTGG - Intronic
1149650237 17:58271993-58272015 TGTTGGGAAGGTGGGTTTTCTGG - Intronic
1151361078 17:73589374-73589396 TGTTGGGGAGCTGGGTATTGAGG + Intronic
1152280849 17:79384150-79384172 GGCAGGGGAGCTGCACTTTCTGG + Intronic
1153915869 18:9743624-9743646 TTCAGGGGATCTGCGTTCTCAGG + Intronic
1155947096 18:31866927-31866949 CATAGGGGAGCTGCATATTCTGG - Exonic
927130025 2:20051284-20051306 TGGAGGGGCGCTGCTTTTTAAGG - Intronic
929003765 2:37375156-37375178 TTAAAGGGAGCTGAGTTTTCTGG + Intergenic
932153612 2:69395191-69395213 TCTAGGGGTACTGCTTTTTCAGG - Intergenic
936195295 2:110365941-110365963 TTTTGGGGAGTTGTGTTTTCAGG - Intergenic
936428246 2:112436988-112437010 TGGAGGGGAGCTGGGGTTGCGGG - Intergenic
949032833 2:241805072-241805094 TGCAGAGTAGCTGCGTTTCCTGG - Intergenic
1170886155 20:20341317-20341339 TGTAGGAGAGCTGCATTTTTTGG - Intronic
1171568966 20:26227464-26227486 TGTAAATGAGCTGGGTTTTCTGG + Intergenic
1175761312 20:61563676-61563698 TGGAAGGGAGCTGCATTTGCAGG - Intronic
1176374006 21:6078223-6078245 TGGAGGGGAGCTGGGGTTGCGGG + Intergenic
1177720811 21:24904357-24904379 TGTAGGAGAGCTGCCAATTCTGG + Intergenic
1179749471 21:43460020-43460042 TGGAGGGGAGCTGGGGTTGCGGG - Intergenic
1180583382 22:16862937-16862959 TTTTGGGCAGCTGTGTTTTCAGG - Intergenic
1181024808 22:20122085-20122107 TGTTGGGCTGCTGCGCTTTCTGG + Intronic
1182046048 22:27274949-27274971 TGTATGGGAGTTGAGTGTTCTGG - Intergenic
952701107 3:36328614-36328636 TGTAGGTGAGAAGGGTTTTCTGG - Intergenic
955782882 3:62505137-62505159 TTTAGGGAAGCTGGGTATTCAGG - Intronic
956653599 3:71528094-71528116 TGTTGGGGATCTGCATTTTTAGG - Intronic
956872692 3:73433751-73433773 TGTAAGGGAGCTGCTTTTCCCGG - Intronic
958016753 3:87946330-87946352 TGTATGGGAGCTCTGTTTTCAGG - Intergenic
960695207 3:120389174-120389196 GGTGGGTGAGCTGCTTTTTCGGG + Intergenic
963745500 3:149120355-149120377 TGTAGGGGAGGGGTGTTTTGGGG + Intergenic
966257527 3:177934506-177934528 TTTAAGGGAGATGCCTTTTCCGG - Intergenic
972709447 4:41579910-41579932 TGCAGAGGAGCTGCTTTTTAAGG + Intronic
975684151 4:76903189-76903211 TGTAGCGGAGCTGCATGTCCAGG + Intergenic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
981808312 4:148742657-148742679 TGTAGGTGATCTGCTTTCTCTGG - Intergenic
982447591 4:155511749-155511771 TTCAGGAGAGCTGCCTTTTCAGG - Intergenic
982750708 4:159157912-159157934 GGTAGGGAAGCTGGGTTTTGAGG + Intronic
982941579 4:161564759-161564781 TGTAGGGGAGATGCCTATTGCGG + Intronic
984952658 4:185018730-185018752 ATTAGGGGAGCTGCGTTTGGAGG - Intergenic
987121167 5:14768400-14768422 TGAAGGAGAGCTGCTTTTCCAGG + Intronic
987192470 5:15492395-15492417 TATACAGGAGCTGAGTTTTCTGG - Intergenic
987223680 5:15817669-15817691 TGCAGGGGAACTGCCTTTTATGG - Intronic
1001397844 5:171429469-171429491 GTTAGGGGAGCTGCGTTTTCAGG + Intronic
1002047554 5:176550377-176550399 TGGCGGGGAGCTGCGTGCTCAGG + Intronic
1004796824 6:19095612-19095634 GGTAGGGGATCAGGGTTTTCAGG - Intergenic
1006060342 6:31414312-31414334 TGGGGTGGAGCTGCGTTTCCAGG + Intronic
1007176085 6:39898704-39898726 TGAAGGGGAGGTGCTTTGTCAGG + Intronic
1014064756 6:117111423-117111445 TGTTGGGCTGCTGCGTTTGCTGG - Intergenic
1016272129 6:142301747-142301769 TGTGGGGCAGCTGCGCCTTCGGG + Intergenic
1017749724 6:157479990-157480012 GGTAGGGGAGCTTGGTTTGCAGG + Intronic
1019322283 7:421181-421203 TGTTGGGGAGCGTCGTTTCCAGG - Intergenic
1019322308 7:421289-421311 TGTTGGGGAGCGTCGTTTCCAGG - Intergenic
1019322332 7:421397-421419 TGTTGGGGAGCGTCGTTTCCAGG - Intergenic
1019322343 7:421451-421473 TGTTGGGGAGCGTCGTTTCCGGG - Intergenic
1026472749 7:70708250-70708272 TGCGGAGGAGCTGGGTTTTCGGG - Intronic
1027777216 7:82481467-82481489 TGTAGAAGAGCTGTGATTTCTGG + Intergenic
1030437323 7:109540091-109540113 TGTGGGGGAGCTGGGTTCTGTGG + Intergenic
1033165363 7:139035242-139035264 TATGGGGGAGCAGCGATTTCCGG + Intronic
1036391435 8:8327829-8327851 TGAAGTGGAGCTCCTTTTTCTGG + Exonic
1037435281 8:18856169-18856191 TGTGGGGGTGCTGCATTTTGAGG - Intronic
1039298768 8:36186614-36186636 TGTAGTGGAGATGTGATTTCAGG + Intergenic
1046002991 8:108443768-108443790 TTTCGGGGAGCTGGGTTCTCTGG + Intronic
1047163209 8:122405118-122405140 TGTAGAGGAGCTGATTTTTTTGG - Intergenic
1054788965 9:69236892-69236914 TGCATGTTAGCTGCGTTTTCTGG + Intronic
1059827366 9:118045915-118045937 TGTAGGGGAGGTGGGTGTTTTGG + Intergenic
1197154278 X:123253161-123253183 TGTTGGGTAACTGGGTTTTCAGG + Intronic
1200607614 Y:5286178-5286200 TGTAGGTGTGTTGCGTTATCTGG + Intronic