ID: 1078514175

View in Genome Browser
Species Human (GRCh38)
Location 11:12008749-12008771
Sequence TGTAGGGGAGCTGCGTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078514175_1078514187 29 Left 1078514175 11:12008749-12008771 CCTGAAAACGCAGCTCCCCTACA 0: 1
1: 0
2: 1
3: 9
4: 101
Right 1078514187 11:12008801-12008823 GCCCGAGCCCCGATCGCCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078514175 Original CRISPR TGTAGGGGAGCTGCGTTTTC AGG (reversed) Intronic