ID: 1078514187

View in Genome Browser
Species Human (GRCh38)
Location 11:12008801-12008823
Sequence GCCCGAGCCCCGATCGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 126}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078514181_1078514187 -9 Left 1078514181 11:12008787-12008809 CCCCACCCGCTCCAGCCCGAGCC 0: 1
1: 0
2: 7
3: 50
4: 498
Right 1078514187 11:12008801-12008823 GCCCGAGCCCCGATCGCCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 126
1078514179_1078514187 6 Left 1078514179 11:12008772-12008794 CCCGAAAAGACGCGACCCCACCC 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1078514187 11:12008801-12008823 GCCCGAGCCCCGATCGCCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 126
1078514180_1078514187 5 Left 1078514180 11:12008773-12008795 CCGAAAAGACGCGACCCCACCCG 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1078514187 11:12008801-12008823 GCCCGAGCCCCGATCGCCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 126
1078514175_1078514187 29 Left 1078514175 11:12008749-12008771 CCTGAAAACGCAGCTCCCCTACA 0: 1
1: 0
2: 1
3: 9
4: 101
Right 1078514187 11:12008801-12008823 GCCCGAGCCCCGATCGCCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 126
1078514174_1078514187 30 Left 1078514174 11:12008748-12008770 CCCTGAAAACGCAGCTCCCCTAC 0: 1
1: 0
2: 1
3: 6
4: 112
Right 1078514187 11:12008801-12008823 GCCCGAGCCCCGATCGCCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 126
1078514176_1078514187 14 Left 1078514176 11:12008764-12008786 CCCCTACACCCGAAAAGACGCGA 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1078514187 11:12008801-12008823 GCCCGAGCCCCGATCGCCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 126
1078514178_1078514187 12 Left 1078514178 11:12008766-12008788 CCTACACCCGAAAAGACGCGACC 0: 1
1: 0
2: 0
3: 4
4: 19
Right 1078514187 11:12008801-12008823 GCCCGAGCCCCGATCGCCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 126
1078514177_1078514187 13 Left 1078514177 11:12008765-12008787 CCCTACACCCGAAAAGACGCGAC 0: 1
1: 0
2: 0
3: 0
4: 9
Right 1078514187 11:12008801-12008823 GCCCGAGCCCCGATCGCCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 126
1078514182_1078514187 -10 Left 1078514182 11:12008788-12008810 CCCACCCGCTCCAGCCCGAGCCC 0: 1
1: 0
2: 1
3: 52
4: 452
Right 1078514187 11:12008801-12008823 GCCCGAGCCCCGATCGCCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078514187 Original CRISPR GCCCGAGCCCCGATCGCCCC AGG Intronic