ID: 1078515602

View in Genome Browser
Species Human (GRCh38)
Location 11:12019480-12019502
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078515595_1078515602 27 Left 1078515595 11:12019430-12019452 CCTAGCCAACAAAGCTTTGCAAA No data
Right 1078515602 11:12019480-12019502 GTGTGCTCAGCTGGGGCTCATGG No data
1078515596_1078515602 22 Left 1078515596 11:12019435-12019457 CCAACAAAGCTTTGCAAAGTGAT No data
Right 1078515602 11:12019480-12019502 GTGTGCTCAGCTGGGGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078515602 Original CRISPR GTGTGCTCAGCTGGGGCTCA TGG Intergenic