ID: 1078517753

View in Genome Browser
Species Human (GRCh38)
Location 11:12039156-12039178
Sequence TGTCCTTTGCAGCACATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078517751_1078517753 -2 Left 1078517751 11:12039135-12039157 CCATAAAAAAGAACAGGATTATG No data
Right 1078517753 11:12039156-12039178 TGTCCTTTGCAGCACATGGATGG No data
1078517749_1078517753 16 Left 1078517749 11:12039117-12039139 CCATGGAATACTAAACAGCCATA 0: 13
1: 1331
2: 27935
3: 15790
4: 7867
Right 1078517753 11:12039156-12039178 TGTCCTTTGCAGCACATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078517753 Original CRISPR TGTCCTTTGCAGCACATGGA TGG Intergenic
No off target data available for this crispr