ID: 1078519351

View in Genome Browser
Species Human (GRCh38)
Location 11:12050949-12050971
Sequence GCTGTTTGCTCTCTACATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078519351_1078519357 16 Left 1078519351 11:12050949-12050971 CCAGCATGTAGAGAGCAAACAGC No data
Right 1078519357 11:12050988-12051010 TATGAATAGGGCCCAGCTATGGG No data
1078519351_1078519361 27 Left 1078519351 11:12050949-12050971 CCAGCATGTAGAGAGCAAACAGC No data
Right 1078519361 11:12050999-12051021 CCCAGCTATGGGGGTCCCCACGG No data
1078519351_1078519359 18 Left 1078519351 11:12050949-12050971 CCAGCATGTAGAGAGCAAACAGC No data
Right 1078519359 11:12050990-12051012 TGAATAGGGCCCAGCTATGGGGG No data
1078519351_1078519355 4 Left 1078519351 11:12050949-12050971 CCAGCATGTAGAGAGCAAACAGC No data
Right 1078519355 11:12050976-12050998 GGATGTGCAAAATATGAATAGGG No data
1078519351_1078519358 17 Left 1078519351 11:12050949-12050971 CCAGCATGTAGAGAGCAAACAGC No data
Right 1078519358 11:12050989-12051011 ATGAATAGGGCCCAGCTATGGGG No data
1078519351_1078519354 3 Left 1078519351 11:12050949-12050971 CCAGCATGTAGAGAGCAAACAGC No data
Right 1078519354 11:12050975-12050997 AGGATGTGCAAAATATGAATAGG No data
1078519351_1078519356 15 Left 1078519351 11:12050949-12050971 CCAGCATGTAGAGAGCAAACAGC No data
Right 1078519356 11:12050987-12051009 ATATGAATAGGGCCCAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078519351 Original CRISPR GCTGTTTGCTCTCTACATGC TGG (reversed) Intergenic