ID: 1078519353

View in Genome Browser
Species Human (GRCh38)
Location 11:12050973-12050995
Sequence TATTCATATTTTGCACATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078519353_1078519361 3 Left 1078519353 11:12050973-12050995 CCAGGATGTGCAAAATATGAATA No data
Right 1078519361 11:12050999-12051021 CCCAGCTATGGGGGTCCCCACGG No data
1078519353_1078519359 -6 Left 1078519353 11:12050973-12050995 CCAGGATGTGCAAAATATGAATA No data
Right 1078519359 11:12050990-12051012 TGAATAGGGCCCAGCTATGGGGG No data
1078519353_1078519367 22 Left 1078519353 11:12050973-12050995 CCAGGATGTGCAAAATATGAATA No data
Right 1078519367 11:12051018-12051040 ACGGTTGTCATCAGTGAAAAGGG No data
1078519353_1078519366 21 Left 1078519353 11:12050973-12050995 CCAGGATGTGCAAAATATGAATA No data
Right 1078519366 11:12051017-12051039 CACGGTTGTCATCAGTGAAAAGG No data
1078519353_1078519356 -9 Left 1078519353 11:12050973-12050995 CCAGGATGTGCAAAATATGAATA No data
Right 1078519356 11:12050987-12051009 ATATGAATAGGGCCCAGCTATGG No data
1078519353_1078519358 -7 Left 1078519353 11:12050973-12050995 CCAGGATGTGCAAAATATGAATA No data
Right 1078519358 11:12050989-12051011 ATGAATAGGGCCCAGCTATGGGG No data
1078519353_1078519357 -8 Left 1078519353 11:12050973-12050995 CCAGGATGTGCAAAATATGAATA No data
Right 1078519357 11:12050988-12051010 TATGAATAGGGCCCAGCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078519353 Original CRISPR TATTCATATTTTGCACATCC TGG (reversed) Intergenic