ID: 1078519356

View in Genome Browser
Species Human (GRCh38)
Location 11:12050987-12051009
Sequence ATATGAATAGGGCCCAGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078519353_1078519356 -9 Left 1078519353 11:12050973-12050995 CCAGGATGTGCAAAATATGAATA No data
Right 1078519356 11:12050987-12051009 ATATGAATAGGGCCCAGCTATGG No data
1078519351_1078519356 15 Left 1078519351 11:12050949-12050971 CCAGCATGTAGAGAGCAAACAGC No data
Right 1078519356 11:12050987-12051009 ATATGAATAGGGCCCAGCTATGG No data
1078519350_1078519356 21 Left 1078519350 11:12050943-12050965 CCGAGGCCAGCATGTAGAGAGCA No data
Right 1078519356 11:12050987-12051009 ATATGAATAGGGCCCAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078519356 Original CRISPR ATATGAATAGGGCCCAGCTA TGG Intergenic