ID: 1078521730

View in Genome Browser
Species Human (GRCh38)
Location 11:12069126-12069148
Sequence CACTGTGCCCAGCTGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078521730_1078521734 -6 Left 1078521730 11:12069126-12069148 CCCTCTTCCAGCTGGGCACAGTG No data
Right 1078521734 11:12069143-12069165 ACAGTGCTCCTTTTGGCTCCAGG No data
1078521730_1078521737 18 Left 1078521730 11:12069126-12069148 CCCTCTTCCAGCTGGGCACAGTG No data
Right 1078521737 11:12069167-12069189 GCAGAACCCAAGTGTACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078521730 Original CRISPR CACTGTGCCCAGCTGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr