ID: 1078524326

View in Genome Browser
Species Human (GRCh38)
Location 11:12089154-12089176
Sequence AAGTGGGTATGCAGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 405}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078524326_1078524339 20 Left 1078524326 11:12089154-12089176 CCAGCCTCCCTGCATACCCACTT 0: 1
1: 0
2: 4
3: 49
4: 405
Right 1078524339 11:12089197-12089219 ACACTGAGCTGCTGGGGGAAAGG 0: 1
1: 0
2: 6
3: 50
4: 455
1078524326_1078524338 15 Left 1078524326 11:12089154-12089176 CCAGCCTCCCTGCATACCCACTT 0: 1
1: 0
2: 4
3: 49
4: 405
Right 1078524338 11:12089192-12089214 GGCAAACACTGAGCTGCTGGGGG 0: 1
1: 0
2: 3
3: 19
4: 245
1078524326_1078524341 29 Left 1078524326 11:12089154-12089176 CCAGCCTCCCTGCATACCCACTT 0: 1
1: 0
2: 4
3: 49
4: 405
Right 1078524341 11:12089206-12089228 TGCTGGGGGAAAGGCCTGCAGGG 0: 1
1: 0
2: 0
3: 49
4: 369
1078524326_1078524340 28 Left 1078524326 11:12089154-12089176 CCAGCCTCCCTGCATACCCACTT 0: 1
1: 0
2: 4
3: 49
4: 405
Right 1078524340 11:12089205-12089227 CTGCTGGGGGAAAGGCCTGCAGG 0: 1
1: 0
2: 8
3: 37
4: 397
1078524326_1078524337 14 Left 1078524326 11:12089154-12089176 CCAGCCTCCCTGCATACCCACTT 0: 1
1: 0
2: 4
3: 49
4: 405
Right 1078524337 11:12089191-12089213 TGGCAAACACTGAGCTGCTGGGG 0: 1
1: 0
2: 1
3: 23
4: 234
1078524326_1078524334 -6 Left 1078524326 11:12089154-12089176 CCAGCCTCCCTGCATACCCACTT 0: 1
1: 0
2: 4
3: 49
4: 405
Right 1078524334 11:12089171-12089193 CCACTTCATCACACAGGGAATGG 0: 1
1: 0
2: 0
3: 22
4: 314
1078524326_1078524336 13 Left 1078524326 11:12089154-12089176 CCAGCCTCCCTGCATACCCACTT 0: 1
1: 0
2: 4
3: 49
4: 405
Right 1078524336 11:12089190-12089212 ATGGCAAACACTGAGCTGCTGGG 0: 1
1: 0
2: 0
3: 22
4: 156
1078524326_1078524335 12 Left 1078524326 11:12089154-12089176 CCAGCCTCCCTGCATACCCACTT 0: 1
1: 0
2: 4
3: 49
4: 405
Right 1078524335 11:12089189-12089211 AATGGCAAACACTGAGCTGCTGG 0: 1
1: 0
2: 1
3: 11
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078524326 Original CRISPR AAGTGGGTATGCAGGGAGGC TGG (reversed) Intergenic
902322159 1:15675667-15675689 AGGTAGGTAGGCAGGCAGGCAGG - Intergenic
902322167 1:15675703-15675725 AGGTAGGTAGGCAGGCAGGCAGG - Intergenic
902322192 1:15675818-15675840 AGGTAGGTAGGCAGGCAGGCAGG - Intergenic
902322222 1:15675958-15675980 AGGTAGGTAGGCAGGCAGGCAGG - Intergenic
902322231 1:15675994-15676016 AGGTAGGTAGGCAGGAAGGCAGG - Intergenic
902694856 1:18133358-18133380 CAGTGGGTTTGCAGAGTGGCTGG + Intronic
902920843 1:19665314-19665336 AAGTGGGAACGCGGGGAGGTGGG - Exonic
903140473 1:21335909-21335931 CAGTGGGTCTCCAGGGAGGGAGG + Intronic
903331712 1:22600058-22600080 AAGGGGGGATGGAGGGAGGAAGG + Intronic
903861104 1:26364952-26364974 AAGTGGGTATCCAGGGTAGAAGG + Exonic
903963621 1:27072721-27072743 AAGGGGGCAGGCACGGAGGCAGG + Intergenic
904316589 1:29670022-29670044 AAGTGGTAATGCAGGGATCCAGG - Intergenic
905031039 1:34884880-34884902 AAGAGGATGTGCAGGGAGACTGG + Intronic
905209093 1:36361176-36361198 AAATGGGTGGGCTGGGAGGCAGG - Intronic
905467445 1:38166146-38166168 AAGTGTGGAGGCAGGGAGGCAGG + Intergenic
906324272 1:44834554-44834576 AAGTGGGTTTGCTGAGAGGAAGG + Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907623019 1:56001302-56001324 AAGTGGGTAAGAAGGAAGGAAGG + Intergenic
909125435 1:71662367-71662389 AAGTGGTTATGCATGGAGAACGG + Intronic
909582927 1:77258365-77258387 AAGGGGATATGAAGAGAGGCCGG + Intergenic
909851008 1:80463889-80463911 AATGAGGTAGGCAGGGAGGCAGG + Intergenic
912529948 1:110313010-110313032 AGCTGGTTATGCAGGGACGCAGG - Intergenic
912927197 1:113923749-113923771 AAGTGGGGTGGCAGGGAGGGAGG - Intergenic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
913391431 1:118317585-118317607 AAGCAGGTAGGCAGGTAGGCGGG - Intergenic
914321398 1:146565491-146565513 AAATTGATATCCAGGGAGGCTGG - Intergenic
914433396 1:147639901-147639923 AAGGGAGTGTGCCGGGAGGCTGG - Intronic
914924371 1:151871711-151871733 AAGTGGATACGAAGGGAGGCAGG + Intergenic
915284404 1:154843592-154843614 TAGCGAGTATGCAGGGAGGCTGG + Intronic
915720633 1:157982578-157982600 TAGGGGGTATGAGGGGAGGCAGG + Intergenic
920455381 1:206097238-206097260 AAGGAGGGCTGCAGGGAGGCAGG - Intronic
920534983 1:206731527-206731549 AAGAGGGGGTGCATGGAGGCAGG - Intronic
920653961 1:207860894-207860916 AAGTGGTGATGCAAGGAGGAGGG + Intergenic
921408474 1:214808719-214808741 AACTCGGTATGAAGGAAGGCAGG + Intergenic
922077996 1:222266878-222266900 AAATGAGTCAGCAGGGAGGCAGG - Intergenic
923306377 1:232692566-232692588 AAGAGGGTAGGCAGTGAGGTAGG + Intergenic
923776485 1:236983273-236983295 AAGTGTGTATGCAGACAGGAAGG + Intergenic
924357845 1:243202298-243202320 AAGTGGGGAAGCCGGAAGGCGGG + Intronic
924373035 1:243375125-243375147 AGGTGGGTATGTAGGGTGGGTGG + Intronic
924619615 1:245649352-245649374 GCGTGGGTCTGCAGTGAGGCTGG - Intronic
1062787787 10:279643-279665 AAGGGGCAGTGCAGGGAGGCTGG + Intronic
1063477868 10:6344398-6344420 AAAGGGGTAGGCAGGGATGCAGG + Intergenic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1064203867 10:13306374-13306396 ACGTGTGTGTGCAGGGAGGCTGG + Intergenic
1064288234 10:14011342-14011364 AAAGGGGGAGGCAGGGAGGCTGG + Intronic
1065833879 10:29639889-29639911 AAGTGGGAATTCAGGGAGTTTGG - Intronic
1065897280 10:30175111-30175133 AAGAGGGTATGAAGGGAAGTTGG - Intergenic
1066298221 10:34074763-34074785 AAGTGGGGAGGAAGGAAGGCAGG + Intergenic
1067080250 10:43208647-43208669 AGGTGGGTCTCCAGGTAGGCAGG - Intronic
1067102021 10:43340748-43340770 AAGTGCGCATGCAGGGAGTCCGG + Intergenic
1067200974 10:44171873-44171895 AAATGGGTAAGCAGGGAGGCAGG + Intergenic
1067463030 10:46472131-46472153 GAGTGGCCATGCAGGGAGGCAGG + Intergenic
1067624164 10:47912507-47912529 GAGTGGCCATGCAGGGAGGCAGG - Intergenic
1067832012 10:49615805-49615827 AGGGAGGTATGCAGGGAGGCTGG - Intronic
1068701243 10:60022471-60022493 ATGTGGTTATACAGGTAGGCAGG + Intergenic
1069524578 10:69157607-69157629 AAGTCTGTATGCAGGAAGCCAGG + Intronic
1069605744 10:69737612-69737634 AAGTGGGGATGTGGGCAGGCTGG - Intergenic
1069728220 10:70594831-70594853 AAGTGAGCCGGCAGGGAGGCTGG - Intergenic
1069797704 10:71063759-71063781 AGGAGGGTGTGCAGGGAGCCCGG + Intergenic
1071259889 10:83910164-83910186 AAGTGAGGAAGCAGGGAGCCAGG + Intergenic
1071437034 10:85657038-85657060 AGGTGGGAGGGCAGGGAGGCTGG - Intronic
1073255495 10:102148340-102148362 AAGAGGGCATGCAGGAATGCTGG - Intronic
1073582476 10:104681095-104681117 AAGTGGGAAAGCAGGGAGACCGG - Intronic
1074079551 10:110156844-110156866 AAGTGTGGATTCAGAGAGGCAGG + Intergenic
1074279765 10:112039824-112039846 AAGTGGATGGTCAGGGAGGCTGG + Intergenic
1075168542 10:120091620-120091642 AAGTGGATGGGCAGGGAGGTTGG + Intergenic
1075604991 10:123798313-123798335 TAGTTGGTATGCAGGGAGTGGGG + Intronic
1075710927 10:124530168-124530190 AGGTGGGCATGCAAGAAGGCCGG - Intronic
1075799106 10:125141857-125141879 AAGTGGCTTTGGAGGGAGCCGGG - Intronic
1077299501 11:1840474-1840496 AGGTGGGTCTGCAGGGGAGCTGG + Intronic
1077366351 11:2162846-2162868 GAGTGTGTAGGGAGGGAGGCTGG + Intergenic
1077376005 11:2205398-2205420 AAGTGGGGAGGCTGGAAGGCTGG - Intergenic
1077376177 11:2205908-2205930 AAGTGAGGATGCTGGGAGGTGGG - Intergenic
1077881002 11:6350058-6350080 AAGTATGGATACAGGGAGGCAGG - Intergenic
1078197309 11:9146696-9146718 TTGTGGGTATGCAGGGAGGGAGG + Intronic
1078310988 11:10241979-10242001 AAGTGGGTCTGCAGGGAGTAGGG - Intronic
1078469468 11:11575468-11575490 AGGAGGGTAGGCAAGGAGGCTGG + Intronic
1078524326 11:12089154-12089176 AAGTGGGTATGCAGGGAGGCTGG - Intergenic
1079722105 11:23828285-23828307 AAGTAGGTATGATGGGAGCCTGG - Intergenic
1079862367 11:25689307-25689329 AAGTAGGTATTGAGGGGGGCTGG + Intergenic
1080649105 11:34208922-34208944 AAGGGGGTAAGCCTGGAGGCAGG - Intronic
1081655824 11:44856833-44856855 AAGTGTGTAGGGAGGGAGGGAGG - Intronic
1081830125 11:46102975-46102997 AAGAGGGTAAGCAGAGAAGCAGG + Intronic
1083262616 11:61531380-61531402 AAGGGGCTGTGCAGGGAGGCAGG + Intronic
1084198042 11:67537073-67537095 AGGTGGGAATGGAGGTAGGCAGG - Intergenic
1084947018 11:72643656-72643678 AGGTGGGGAGGCTGGGAGGCTGG - Intronic
1085004619 11:73074929-73074951 CAGTGGGGAGGGAGGGAGGCAGG + Intronic
1085334309 11:75679245-75679267 AAGTGGGTGTGCTGGGAGATGGG + Intergenic
1085445506 11:76598274-76598296 AAGTGGGCAGGCAGGCAGGTGGG - Intergenic
1085510625 11:77086425-77086447 AAGGTGGGGTGCAGGGAGGCAGG - Intronic
1085828377 11:79872766-79872788 ACGTGAGAATGGAGGGAGGCAGG + Intergenic
1086237148 11:84645142-84645164 AACTGGTTATGAAGGGAGACAGG + Intronic
1086261201 11:84943381-84943403 ATGTGGGAATGCAGGAAGGCAGG - Intronic
1087635209 11:100694552-100694574 AGGTGGAGCTGCAGGGAGGCTGG - Intronic
1088504417 11:110514318-110514340 AAGTAGGCAGGCAGGCAGGCAGG + Intergenic
1088524400 11:110737489-110737511 AAGTGTGTATGCAGTGGGGAAGG - Intergenic
1089188307 11:116636048-116636070 AGGTGGGTGTGCATGAAGGCAGG + Intergenic
1090429623 11:126635146-126635168 AAAAGGGTCTGCAGTGAGGCAGG + Intronic
1090806993 11:130209006-130209028 GGGTGGGTATGAAGGGAAGCAGG + Intronic
1091187940 11:133663311-133663333 ATGTGGGTCTGCAGAGAGGCTGG - Intergenic
1091235180 11:134017156-134017178 GAGTGGCACTGCAGGGAGGCAGG + Intergenic
1091756338 12:3054730-3054752 AGGTAGGAAGGCAGGGAGGCAGG - Intergenic
1092529379 12:9331883-9331905 CAGTGTGGCTGCAGGGAGGCTGG + Intergenic
1094121613 12:26980521-26980543 AACTGGGTATTCAAGAAGGCAGG - Intronic
1095154645 12:38837610-38837632 TAATGGGTAAACAGGGAGGCTGG + Intronic
1096227298 12:49874422-49874444 GAGTGGGCTTGCAGGGAGGGAGG + Intronic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1096604922 12:52757835-52757857 AGGTGGGTGTGGAGGCAGGCAGG - Intergenic
1096696393 12:53351633-53351655 AAGAAGGTGGGCAGGGAGGCCGG + Intergenic
1096722622 12:53534583-53534605 AAGTGGAGAGGCAGGGAGCCAGG + Exonic
1097998616 12:65917174-65917196 AAGTGGTAATGCATGGAGGGAGG + Intronic
1098251799 12:68577833-68577855 AAGTGGTTTTGGAGGGAGGAGGG - Intergenic
1098451705 12:70626390-70626412 AGGTAGGTAGGCAGGCAGGCAGG - Intronic
1099454664 12:82849190-82849212 AAGTGGGAATGAAGGCAGGCAGG + Intronic
1099943414 12:89217415-89217437 AGGTGGGCAGGCAGGCAGGCAGG + Intergenic
1100377167 12:94028345-94028367 AAGTCTGGATGCAGGGAGACAGG - Intergenic
1100638505 12:96458836-96458858 AAAGGGATATGAAGGGAGGCTGG - Intergenic
1101015326 12:100494655-100494677 AAGTGGCTAGACATGGAGGCAGG - Intronic
1101638305 12:106565878-106565900 AAGGGGGTAGGGAGGGAGGAAGG + Intronic
1101682558 12:106983965-106983987 AGGTGGGTATGGAGGTAGGTGGG - Intronic
1101883972 12:108645731-108645753 ACGTCTGTATGCAGGGAGCCAGG - Exonic
1102782257 12:115575492-115575514 GAATGGGTAGGCAGGGATGCTGG - Intergenic
1102987969 12:117294112-117294134 AACTGGGTATGTAGGGAGAATGG - Intronic
1103223396 12:119265821-119265843 AAGTGGGGAGGCAGAGAGGGAGG + Intergenic
1104191078 12:126482445-126482467 AAGTGGGGAAGGAGGGAGGGAGG - Intergenic
1104511328 12:129381865-129381887 AAGTGGTTATGCTGGGCAGCAGG - Intronic
1104749518 12:131229550-131229572 AGGTGGGTCTGCAGGGAGGCCGG - Intergenic
1104750152 12:131233180-131233202 AAGGGGGTCTGCACGCAGGCAGG + Intergenic
1104782564 12:131431281-131431303 AAGGGGGTCTGCACGCAGGCAGG - Intergenic
1107016235 13:35709780-35709802 AAGTGGGTATTGGGAGAGGCAGG - Intergenic
1107871886 13:44754384-44754406 AATTCTGTATGCAGGTAGGCCGG + Intergenic
1108620429 13:52177762-52177784 AAGTGTGTAAACAGGTAGGCTGG - Intergenic
1109862145 13:68213988-68214010 AAGTGGGGAGGAAGGGAGGAGGG - Intergenic
1110037516 13:70707186-70707208 AAATGTGGATGCAGGGAGGCTGG + Intergenic
1113817858 13:113187454-113187476 CAGTGAGGATGCAGGGAGACTGG - Intronic
1114191272 14:20441041-20441063 AGGCGGGTGTGCAGGGAGTCAGG + Intergenic
1114221526 14:20701798-20701820 AAGGGGGAATGCAGGGTGGAAGG - Intergenic
1114617612 14:24076582-24076604 GAGTGTGTCTGCGGGGAGGCGGG - Intronic
1115756248 14:36528245-36528267 GAGGGGGTAGGCAGGGAGGCAGG - Intergenic
1116428409 14:44818493-44818515 CAGTGGGGATGCAGGCAGCCAGG - Intergenic
1116890654 14:50264727-50264749 AAGTGGGGAGGGAGGGAGGAAGG + Intronic
1116946369 14:50838979-50839001 AAGGGGGTATGTGGGGAGGCAGG + Intergenic
1117833687 14:59779762-59779784 AAGTGTGTATGCAGAGAGCTGGG - Intronic
1117918890 14:60707094-60707116 ATGTGAGTAGGCAGAGAGGCAGG + Intergenic
1119613453 14:76082909-76082931 AAGTGGGCAGCCATGGAGGCAGG - Intronic
1119652678 14:76394799-76394821 AGGTGGGTATGCAGTGACACTGG - Intronic
1121228754 14:92341044-92341066 AGATGAGTATGCAGGGAGGCCGG + Intronic
1121603223 14:95221486-95221508 AAGTGGGTGGGCACGGAGTCAGG + Intronic
1122822937 14:104356159-104356181 AGGAAGGCATGCAGGGAGGCGGG + Intergenic
1122855759 14:104559420-104559442 AGATGGGGATGGAGGGAGGCCGG - Intronic
1124371450 15:29106860-29106882 AAGTGGGGATGAAGTGAGGCAGG - Intronic
1124651563 15:31477881-31477903 AGGTGGGTAGGGAGGGAGGGTGG + Exonic
1126796271 15:52262548-52262570 AAGTGGGAAAGCAGGGAGAGAGG - Intronic
1127603891 15:60566880-60566902 AAGTGGGTAGCCAGGTTGGCGGG + Intronic
1128073330 15:64810800-64810822 AAGGTGGTATGTGGGGAGGCTGG - Intergenic
1128453118 15:67818588-67818610 AGGGGTGTATGCAGGGAGGGAGG + Intergenic
1128677815 15:69624663-69624685 AGGTGGGAAGGCAGGCAGGCAGG - Intergenic
1128818842 15:70634264-70634286 AAGTGGGGATGAAGGGCGGATGG + Intergenic
1129384091 15:75185978-75186000 AAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1129410476 15:75348002-75348024 AAGTGGCAAAGCAGGGAGGGCGG + Intronic
1129654426 15:77514630-77514652 AAGAGGCTAGGGAGGGAGGCAGG + Intergenic
1131588233 15:93719115-93719137 TATTGGGCAGGCAGGGAGGCTGG - Intergenic
1131946062 15:97623259-97623281 AAGTGGGGATGTGAGGAGGCTGG + Intergenic
1132977951 16:2719913-2719935 AAGTGGGGAGGCAGGGTGGGAGG - Intronic
1134208063 16:12253708-12253730 AGGTTGGTAGGCAGGGAGGCTGG + Intronic
1135110168 16:19684478-19684500 AAGATGTAATGCAGGGAGGCTGG + Intronic
1136741042 16:32527065-32527087 ATCTGGGTATGCATTGAGGCCGG - Intergenic
1138482576 16:57313317-57313339 CAGAGGGTATGAGGGGAGGCTGG + Intergenic
1139210031 16:65068017-65068039 AAGAGGGAAAGCAGGGAGGGAGG + Intronic
1140012229 16:71145655-71145677 AAATTGATATCCAGGGAGGCTGG + Intronic
1140729128 16:77840262-77840284 AGGTGGGGAGGCAGGGAGGCAGG + Intronic
1140896105 16:79325724-79325746 AAGTGAGAAGGCAGGAAGGCAGG + Intergenic
1140905190 16:79403487-79403509 CAGTGGGCATGCACAGAGGCAGG - Intergenic
1141770586 16:86087372-86087394 AAATGGGTATGTCGGGAGGTCGG + Intergenic
1203028561 16_KI270728v1_random:548169-548191 ATCTGGGTATGCATTGAGGCCGG + Intergenic
1203043160 16_KI270728v1_random:786262-786284 ATCTGGGTATGCATTGAGGCCGG - Intergenic
1142595698 17:1028878-1028900 AAGAGGGCCTGAAGGGAGGCCGG - Intronic
1143097918 17:4488302-4488324 AAGTGGGGAAGCTGGGGGGCTGG + Intergenic
1143332876 17:6150340-6150362 AAGTGGGTGTGGAGAGAGGGAGG + Intergenic
1143381408 17:6498532-6498554 AAGCAGGAAGGCAGGGAGGCCGG + Intronic
1143618371 17:8067061-8067083 AAGTGGCTATGCTGGGAAGTTGG + Intergenic
1144464472 17:15486023-15486045 AAGTGTGGAACCAGGGAGGCTGG - Intronic
1145251923 17:21301463-21301485 GTGTGGGTGAGCAGGGAGGCCGG + Intronic
1146396845 17:32474803-32474825 ACTTCGGTATGCAGGGAGGCAGG + Exonic
1148104575 17:45112502-45112524 AAGTGGGTGGGCTGGGGGGCTGG + Exonic
1148694810 17:49552454-49552476 CAGTGGGCATGCAGGGCGCCTGG - Intergenic
1150318190 17:64187636-64187658 AAATGGGGAGGTAGGGAGGCTGG - Intronic
1151359989 17:73583026-73583048 GAGTTGGTATGCAAAGAGGCAGG - Intronic
1151579696 17:74971232-74971254 GAGTGGGGAGGCAGGGAGGAAGG - Intronic
1151911323 17:77085333-77085355 AATTTTGTATGCAGGGAGTCAGG - Intergenic
1152026781 17:77815102-77815124 AAGTGGGGAGGGAGGGAGGGAGG - Intergenic
1152273753 17:79341742-79341764 AGATGGTTATGCAGGGAGCCTGG - Intronic
1152310067 17:79544646-79544668 AGGTGTGTCTGCAGGGAGCCTGG - Intergenic
1153543382 18:6181082-6181104 AATAGGGTCTGCAGGGAGGTAGG + Intronic
1154465562 18:14640859-14640881 AAGAGGGTATCCAGTGAGGGGGG - Intergenic
1155024207 18:21926609-21926631 ATGTGGGTTTGCATGGGGGCTGG + Intergenic
1155175538 18:23298262-23298284 AGGTGAGAAGGCAGGGAGGCGGG + Intronic
1157800861 18:50619894-50619916 ATGTGGGTCCACAGGGAGGCTGG + Intronic
1160140992 18:76322830-76322852 AAGTGAGTATGCAGAGACGTGGG + Intergenic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1160973166 19:1779005-1779027 AAGTGGGCATGCGGGGAGGCAGG - Exonic
1161426936 19:4208829-4208851 TAGTGTGGATGCAGGGAGGAGGG - Intronic
1161501903 19:4620846-4620868 AAGTGTGAATGCAGGGAGATGGG + Intergenic
1162547054 19:11337155-11337177 ATCTGGGTAGGCTGGGAGGCTGG - Exonic
1163726221 19:18924580-18924602 AATTGGGAATGCATGAAGGCAGG - Intronic
1164025353 19:21346646-21346668 AAGGGGGTAGGGAGGGAGGGAGG + Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1164683427 19:30150922-30150944 ACATGGGCAGGCAGGGAGGCCGG + Intergenic
1165177392 19:33940247-33940269 AAGGGGAAAGGCAGGGAGGCTGG - Intergenic
1165338709 19:35194645-35194667 AAGTGGAAATGCTAGGAGGCAGG - Intergenic
1166707342 19:44915212-44915234 AAGTGGGTAAGCTGGGTGGGGGG + Intronic
1166876845 19:45902629-45902651 AAGAGGGGAGGGAGGGAGGCGGG - Intergenic
1167489762 19:49785549-49785571 AAGTTGGATTGCAGGGAGTCAGG + Intronic
1168097270 19:54122945-54122967 AAGTGGGGAGGAAGTGAGGCGGG + Intronic
1168151062 19:54449085-54449107 AAGTGCGTGGGCAGGAAGGCGGG + Exonic
1168153364 19:54460614-54460636 AGGTGGGGAGGCTGGGAGGCGGG + Intronic
1168588434 19:57613707-57613729 CAGTGGCTATGGAGGGATGCTGG - Intergenic
925017678 2:543895-543917 AAGGTGGGAGGCAGGGAGGCAGG + Intergenic
925276465 2:2651668-2651690 CTGTGGGAAAGCAGGGAGGCAGG + Intergenic
925358141 2:3257083-3257105 AAGTGGGGATGCAGGCGCGCTGG + Intronic
926048110 2:9724965-9724987 AAGTGGAAAGGCAGTGAGGCAGG - Intergenic
927906557 2:26862781-26862803 AAGTTGGTGGGAAGGGAGGCTGG + Intronic
927974078 2:27324708-27324730 AAGTGGGTATATTGGGAGGGAGG + Intronic
928494403 2:31817449-31817471 AAGTGGGCAAGGAGGGAGGTGGG - Intergenic
929591833 2:43152818-43152840 CAGGGGCTATGCTGGGAGGCAGG + Intergenic
929961739 2:46502381-46502403 TAGTGGGTAAGCCTGGAGGCAGG + Intronic
930696528 2:54417126-54417148 AAGTGGGGATCCAAGGAGGGAGG + Intergenic
931569321 2:63651546-63651568 CATTGGGTAGGCAGGCAGGCAGG + Intronic
932592502 2:73075765-73075787 AAGCGGGCAGGCAGGCAGGCAGG - Intronic
933206497 2:79513240-79513262 AGGTGGGGAGGGAGGGAGGCAGG - Intronic
933705982 2:85290749-85290771 AAGAGGGTAAGCTGGCAGGCTGG + Intronic
933940347 2:87239845-87239867 AGGAGGGCTTGCAGGGAGGCTGG - Intergenic
933979116 2:87536359-87536381 ACCTGGGGTTGCAGGGAGGCAGG - Intergenic
935939979 2:108228092-108228114 AAGCGGGCAGGCAGGCAGGCAGG + Intergenic
936089884 2:109494690-109494712 AAGTGGGAATGCAGGCAGCAGGG + Intronic
936314711 2:111414433-111414455 ACCTGGGGTTGCAGGGAGGCAGG + Intergenic
936352791 2:111725931-111725953 AGGAGGGCTTGCAGGGAGGCTGG + Intergenic
936993007 2:118386096-118386118 AAGTGGGGATGAAGAGAGGGAGG + Intergenic
937071575 2:119067556-119067578 AAGTAGGGATGCAGGAAGGCCGG + Intergenic
941492140 2:166155425-166155447 ATGGGAGGATGCAGGGAGGCAGG + Intergenic
941695945 2:168550909-168550931 AAGTGGGGAGACAGGGAGGCTGG + Intronic
941730677 2:168913681-168913703 AAGTCAGAATGCAGGTAGGCAGG + Intergenic
942764453 2:179437761-179437783 AAGTGGGGAAGAAGGGAGGGGGG + Intergenic
943666568 2:190615488-190615510 ATGTGGAGGTGCAGGGAGGCCGG - Intergenic
944131574 2:196353097-196353119 AAGGGGGTAAGGAGCGAGGCGGG - Intronic
944335296 2:198526597-198526619 AGGTGGGAAGGCAGGGAGGATGG + Intronic
944732321 2:202529336-202529358 ATTTGGGTATGGAGGGAGGGTGG - Intronic
944775549 2:202960685-202960707 AGGTGGGAAGGCAGGAAGGCAGG - Intronic
946046425 2:216824992-216825014 AAGTGGTGATACAGGGAAGCAGG + Intergenic
946853195 2:223927925-223927947 AAGGGGGAAAGGAGGGAGGCAGG + Intronic
947648179 2:231760580-231760602 AACTGGGTATGCAGGATAGCTGG - Intronic
948554628 2:238799607-238799629 AAGAGGGTGTGCAGGTGGGCTGG + Intergenic
948678042 2:239610643-239610665 AGGTGTGGATGCAGGGAGGCAGG + Intergenic
949074104 2:242044360-242044382 GAGTGGGGATGCAGCGAGCCTGG + Intergenic
1168839120 20:897774-897796 AAGGGGGAATGCAGGGTGGAAGG - Intronic
1168897097 20:1331192-1331214 AAGTGGGTGTGCAGTGGGGCAGG - Intronic
1170579613 20:17687893-17687915 AAGGGGGTCTGCAGGCAGGAAGG + Intergenic
1172058041 20:32167826-32167848 ACTTGGGTATGCCGGGGGGCTGG + Intergenic
1172272478 20:33662533-33662555 AAGTGGGTGGGAAGGGATGCTGG + Intronic
1173014675 20:39214427-39214449 AAGTGGGTGTGAAGGGGGGAAGG + Intergenic
1173148105 20:40542928-40542950 AAGTGGATATTCTGAGAGGCAGG - Intergenic
1173398367 20:42702040-42702062 AAGTGGGTAAACAGAGAGGGAGG - Intronic
1173849954 20:46211447-46211469 AAATCAGGATGCAGGGAGGCAGG + Intronic
1174196275 20:48774932-48774954 AAATGGCTCTGCAGGGTGGCAGG + Intronic
1176292723 21:5054814-5054836 AAGTGGGTATTCATGCAGGTAGG + Intergenic
1176413127 21:6459435-6459457 AAGTGAGTTCGGAGGGAGGCAGG - Intergenic
1177046895 21:16182539-16182561 AAGGAGGGATGGAGGGAGGCAGG - Intergenic
1177758387 21:25373911-25373933 AAGTGGGTGGGGAGAGAGGCTGG - Intergenic
1179164410 21:38924579-38924601 CAGTGGATCTGCAGGAAGGCTGG - Intergenic
1179409714 21:41153365-41153387 AGGGAGGTATGCAGGGAGACAGG + Intergenic
1179688622 21:43067757-43067779 AAGTGAGTTCGGAGGGAGGCAGG - Intronic
1179826442 21:43968721-43968743 AAGTGGTTCTGCAGGGACGCAGG - Intronic
1179864537 21:44208836-44208858 AAGTGGGTATTCATGCAGGTAGG - Intergenic
1180115730 21:45703747-45703769 CAGTGGATATGCATGGTGGCTGG + Intronic
1181056310 22:20262016-20262038 AAGATGGTAGGCAGGGAGCCGGG + Intronic
1182095856 22:27625165-27625187 AGGTGGGTATGCAGTGGGACTGG + Intergenic
1182711789 22:32327833-32327855 CAGAGGGTGTGCAGGGAGGCCGG - Intergenic
1183404414 22:37623473-37623495 AGTGGGGTAGGCAGGGAGGCAGG - Intronic
1184245810 22:43235259-43235281 GAGTGGGTGTGCATGGGGGCAGG + Intronic
1184510459 22:44930340-44930362 AAATGGGTAAACAGGGAGGTTGG - Intronic
1184835651 22:47019553-47019575 GTGTGGGTGTGCAGGGAGGGAGG + Intronic
1184873734 22:47258933-47258955 ATGGGGGTGAGCAGGGAGGCAGG + Intergenic
1184881003 22:47304198-47304220 GCGTGGGCCTGCAGGGAGGCTGG - Intergenic
1185226443 22:49656442-49656464 AAGGGGGCATTCAGGGTGGCGGG - Intronic
1185226817 22:49658074-49658096 AAGGGGGCATTCAGGGTGGCGGG - Intergenic
950275504 3:11656944-11656966 AAGAGCGTCTGCAGGGAGGCTGG + Intronic
950526290 3:13526190-13526212 AAGTGGGCTTGCAGAGAGGCAGG + Intergenic
950885964 3:16363020-16363042 AGGTGGGGAGGCTGGGAGGCAGG - Intronic
951463526 3:22977110-22977132 AACTGGGCATGCAGAGAGTCAGG + Intergenic
951998495 3:28757489-28757511 AAGTCAGTCTGCAGGGATGCTGG - Intergenic
953788395 3:45928522-45928544 AAGTGGGTCTGGAGAGAGGGTGG + Intronic
953903717 3:46857767-46857789 AGGTGGGTAGGAAGGGAGGGAGG + Intergenic
953927344 3:46989194-46989216 GAGGGTGTATGCAGGGAGGCAGG + Intronic
954364404 3:50138569-50138591 GACAGGGTCTGCAGGGAGGCAGG - Intergenic
954611482 3:51946786-51946808 AAGGGGATAGGCAGAGAGGCTGG + Intronic
954674319 3:52307356-52307378 CAGTGGGAATGATGGGAGGCTGG + Intergenic
954717797 3:52534939-52534961 AAGTGGGTGTGCTGGGAACCTGG + Intronic
955749613 3:62174378-62174400 TAGAGGGTATGCAGGCAGCCCGG - Intronic
957830845 3:85516441-85516463 AAGTTGGTAGGCAGGTAGGTAGG + Intronic
959937277 3:112042083-112042105 GAGTGGGTTTGCGGGGAGGTGGG + Intronic
961110987 3:124282860-124282882 AAGGGGCCATGCAGGGAGCCAGG - Intronic
962388976 3:134956069-134956091 AAGTTGGACTGCAGGGAGGAAGG + Intronic
962492997 3:135911616-135911638 AAGTGGGTCTGTTGGGAAGCAGG + Intergenic
962559543 3:136591289-136591311 AGGTGGGAAGGCAGGAAGGCAGG + Intronic
962844177 3:139260647-139260669 AGGGGGGTAGGCAGGGAGGGAGG + Intronic
963052254 3:141152233-141152255 CTGTGGGAATGCAGGGAGCCTGG - Intergenic
965151144 3:164976881-164976903 AAGGGGGTATGAAGGGAGATAGG - Intergenic
965404081 3:168249350-168249372 GAGTGTGTATGCTGGGAGGGGGG + Intergenic
965772197 3:172193139-172193161 AGGTGGGAAGGAAGGGAGGCAGG - Intronic
967006102 3:185384078-185384100 AAGAGGGGATGAAGAGAGGCTGG - Intronic
967899980 3:194440054-194440076 ATGTGGGTAGGGAGGGAGGGAGG + Intronic
967966255 3:194962307-194962329 AGCTGGGGGTGCAGGGAGGCGGG - Intergenic
968038259 3:195567051-195567073 AGGTGGGCATGGAGGGAGGAGGG - Intergenic
968660384 4:1796364-1796386 AGGTGGGGAGACAGGGAGGCTGG + Intronic
969002253 4:3991806-3991828 AACTGGGTTAGGAGGGAGGCTGG + Intergenic
971718233 4:30209292-30209314 AAGTGTGAATGAAGGGAGTCAGG - Intergenic
973015396 4:45131063-45131085 AAGTGGCAATGAAGGGAAGCTGG - Intergenic
973192403 4:47400715-47400737 AAGTGGGGAGGCTGGGAGGAGGG - Intronic
973553143 4:52055303-52055325 AAGTGGGCATGAATGAAGGCAGG - Intronic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
975992223 4:80268563-80268585 AAGTGGGTAAGGCGGTAGGCTGG + Intronic
979551671 4:121998173-121998195 GAGTGTGTATGCAAGGGGGCGGG + Intergenic
982389084 4:154845006-154845028 AAGTTGGGATGTGGGGAGGCAGG + Intergenic
983086560 4:163452401-163452423 AAGTGGGTTTGCAGGGATGCAGG + Intergenic
983917957 4:173312551-173312573 ATGTGGCAATGCTGGGAGGCAGG - Intronic
984138308 4:175969805-175969827 AAGTGTGTGTGGAGGGATGCAGG + Intronic
984401583 4:179272303-179272325 TGGTGGGGAGGCAGGGAGGCAGG + Intergenic
984720791 4:182970844-182970866 GAGTGGGGATGTAGGGAGGAAGG + Intergenic
985640157 5:1059806-1059828 GAGTGAGTGTGCAGGGAGGGAGG - Intronic
985710810 5:1428618-1428640 AAGTGGCAATGCAGGAAGGCTGG + Intronic
985933479 5:3077713-3077735 GAGTGGGAAAGGAGGGAGGCTGG + Intergenic
985968949 5:3360347-3360369 CAGTGGGTATTTAGGGAGGAAGG - Intergenic
986587762 5:9336287-9336309 AAGTGGGAATGCAGGGCAGAAGG + Intronic
987735597 5:21838868-21838890 ATGTGGGTATGGATGAAGGCTGG - Intronic
989790813 5:45399114-45399136 AAGTGGCTATCCATGCAGGCAGG - Intronic
991123880 5:63048017-63048039 AGGTGGGAAGGCAGGAAGGCAGG - Intergenic
991769806 5:70029610-70029632 AACTGGGTGTGCTGGGAGGCTGG - Intronic
991849101 5:70905028-70905050 AACTGGGTGTGCTGGGAGGCTGG - Intronic
993161605 5:84298648-84298670 AAGTGGGTGAGAAGGGAGGCTGG - Intronic
993462763 5:88204639-88204661 AAGTGTGTGTGCAGAGAGGAGGG + Intronic
995982205 5:118117955-118117977 AAGTGGGGAGGGAGGGAGGCAGG - Intergenic
997234627 5:132265708-132265730 AGGTGGGTATGAGGTGAGGCTGG - Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998127004 5:139631038-139631060 AAGTGGGGAAGGAGGGAGGGAGG - Intergenic
998351249 5:141503103-141503125 CAGAGGGTATGAAGAGAGGCAGG - Intronic
1001379320 5:171293148-171293170 CAGTGGGCATGCGAGGAGGCAGG - Intronic
1002594320 5:180312192-180312214 AGGCGGGGAGGCAGGGAGGCAGG + Intronic
1003661838 6:8069595-8069617 AAGAAGGTAGGCAGGAAGGCAGG - Intronic
1004305543 6:14498657-14498679 AAGTGGGAAGGAAGGGAGGAAGG - Intergenic
1004426938 6:15513136-15513158 GGGTGTGTCTGCAGGGAGGCCGG + Intronic
1005602687 6:27443778-27443800 AAGTGGGGGTGGAGGGAGGTGGG - Intergenic
1005906301 6:30263798-30263820 AAGGAGGGATGCAGGGAGGAAGG + Intergenic
1006340220 6:33442725-33442747 AAGAGGGCAGGCAGGGAGGATGG - Intronic
1006453242 6:34117483-34117505 TAGTGGGTGGGCAGGGAGCCAGG - Intronic
1006860266 6:37167688-37167710 AAGTATGCATTCAGGGAGGCTGG + Intergenic
1010743692 6:79537204-79537226 AAGAGGGAAGGCAAGGAGGCGGG - Exonic
1011294112 6:85808370-85808392 AAGCTGGGATGCAGGGAGGCAGG + Intergenic
1011823570 6:91280585-91280607 ATGTGGTTCTTCAGGGAGGCTGG + Intergenic
1012837696 6:104291295-104291317 AAGTGGGTGTGGAGGCAGACAGG - Intergenic
1013456253 6:110332075-110332097 CAGAGGGTAGGCTGGGAGGCAGG + Intronic
1014534702 6:122600787-122600809 GAGTAGGCATGCAGGGAAGCAGG + Intronic
1015823190 6:137284358-137284380 AAATAGGGAGGCAGGGAGGCAGG + Intergenic
1016440930 6:144082621-144082643 AAGTGGGTGTGGGGGGAGGGGGG + Intergenic
1019092723 6:169553020-169553042 GTGTGTGTATGCAGGGAGGTGGG + Intronic
1019092736 6:169553088-169553110 GTGTGTGTATGCAGGGAGGTGGG + Intronic
1019591918 7:1839886-1839908 AGGTGGTTATGGGGGGAGGCGGG - Intronic
1019594811 7:1853629-1853651 GTGTGGGTGTGCAGGGCGGCGGG - Intronic
1019772935 7:2895051-2895073 ATCTGGGTCTGCAGGGAGGAGGG + Intergenic
1020257199 7:6508925-6508947 AAGCAGGTGTGGAGGGAGGCGGG - Intronic
1020722255 7:11761897-11761919 AAGGGGGGAAGGAGGGAGGCAGG - Intronic
1023633411 7:42185071-42185093 ACCTGGGCATGCAGGCAGGCAGG + Intronic
1023751710 7:43379327-43379349 GAGTGTGTGTGCAGGCAGGCTGG - Intronic
1023830941 7:44038786-44038808 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1025299349 7:57805739-57805761 AGGAGGGAATGCAGGGAGGAAGG - Intergenic
1027263773 7:76482895-76482917 GACGGGGTATGCAGGGAGGTTGG - Exonic
1027421696 7:78023336-78023358 AGGTAGGCAGGCAGGGAGGCAGG - Intronic
1028310469 7:89327000-89327022 GAATGAGTATGAAGGGAGGCAGG - Intronic
1029160424 7:98547935-98547957 ATGTAGGTAGGCAGGCAGGCAGG - Intergenic
1029160426 7:98547943-98547965 AGGTAGGTATGTAGGTAGGCAGG - Intergenic
1029160430 7:98547963-98547985 AGGTAGGTATGTAGGTAGGCAGG - Intergenic
1029160443 7:98548047-98548069 ATGTAGGTAGGCAGGTAGGCAGG - Intergenic
1029160445 7:98548055-98548077 AGGTAGGTATGTAGGTAGGCAGG - Intergenic
1029160548 7:98548675-98548697 AAGTAGGTAGGTAGGGAGACGGG - Intergenic
1029160571 7:98548783-98548805 AAGTGGGTAGGTAGGTAGACAGG - Intergenic
1029345445 7:99975522-99975544 AAGTGGGAAGGCAGGTTGGCTGG - Intronic
1029346342 7:99981251-99981273 AAGTGGGAAGGCAGGTTGGCTGG + Intergenic
1029741275 7:102493095-102493117 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029759265 7:102592264-102592286 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029776634 7:102688174-102688196 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1029788406 7:102816758-102816780 ATGTGGGGAGGCAGGGAGGATGG - Intronic
1031924841 7:127629502-127629524 AAGTGGCAATGAAGGGAGCCTGG - Intergenic
1033254040 7:139784136-139784158 AAGGGGGAAGGCAGGCAGGCAGG - Intronic
1033453520 7:141482301-141482323 AGGTGGGTGTTCAGGGAGGAAGG - Intergenic
1033735955 7:144222064-144222086 AAGAGGGTGTGCAGGAAGGGAGG - Intergenic
1033747096 7:144328888-144328910 AAGAGGGTGTGCAGGAAGGGAGG + Intergenic
1034234596 7:149556916-149556938 AAGAAGTTATGCATGGAGGCAGG - Intergenic
1035531003 8:350796-350818 AGGTGGGTAGGTAGGCAGGCAGG + Intergenic
1036282764 8:7415764-7415786 AGGCGGGGAGGCAGGGAGGCAGG - Intronic
1036338702 8:7895763-7895785 AGGCGGGGAGGCAGGGAGGCAGG + Intronic
1036614442 8:10377821-10377843 AAGTGGGTCTCCAGGGCAGCCGG + Intronic
1037226738 8:16602003-16602025 GAATGGGGATGCAGGGTGGCTGG - Intergenic
1037606431 8:20441550-20441572 AAGTGGATATGCAAGGGGGAAGG + Intergenic
1038512103 8:28147908-28147930 CAGTGGGTATGCATTCAGGCTGG - Intronic
1038695732 8:29804772-29804794 ACGTGGCTATGAAGGAAGGCAGG - Intergenic
1038885592 8:31659434-31659456 AAGAGGTGATGCAGGGAAGCTGG + Intronic
1040559136 8:48508499-48508521 AAGTGGATATGCAGGATGGAGGG + Intergenic
1041719082 8:60960257-60960279 AGCTGGGTAGGCAGGCAGGCAGG - Intergenic
1042059627 8:64802602-64802624 AAGTAGGGAAGCAGGGAGGGAGG + Intergenic
1042484983 8:69338685-69338707 AGGCGGGTCTGCAGGGTGGCCGG - Intergenic
1042627393 8:70773269-70773291 ATATGGATATGCAGGGAAGCAGG + Intronic
1043676576 8:82963464-82963486 AATTGGGGATGCAGGGCAGCAGG + Intergenic
1043878230 8:85510665-85510687 AATTGGGTGTGCAGGGAGGAAGG - Intergenic
1045827227 8:106412599-106412621 GAGTGAGTACGCAGGGAGTCAGG + Intronic
1046200511 8:110921724-110921746 AAGCGGGGAAGCAGGAAGGCAGG + Intergenic
1047832272 8:128647760-128647782 AGGTGGGCAGGGAGGGAGGCAGG - Intergenic
1048007362 8:130430455-130430477 CAGTGGGTAAGCAGAGAGCCAGG + Intronic
1049265179 8:141664087-141664109 AAGTGGGTATAGACTGAGGCTGG - Intergenic
1052609388 9:30752273-30752295 AAGTGGGTATACAGTAAAGCTGG - Intergenic
1055418636 9:76111723-76111745 AAATGAGTATGCAAGGAAGCAGG + Intronic
1055497092 9:76866740-76866762 AAGTGGGTAAGAAAGGAGGAAGG + Intronic
1056289557 9:85128996-85129018 AAGTGGGGAGGCAGGTAGGTGGG - Intergenic
1056628540 9:88274032-88274054 GGGTGGGGATGGAGGGAGGCTGG + Intergenic
1057503561 9:95614980-95615002 GGGTGCTTATGCAGGGAGGCGGG + Intergenic
1059819545 9:117956818-117956840 AAGTAGGCAGGCAGGCAGGCAGG + Intergenic
1060183162 9:121547596-121547618 AAGTGGTTATGCAGTGAGAGGGG + Intergenic
1060328217 9:122639009-122639031 AAGTGAGTAAGCAGGCAAGCAGG - Intergenic
1060937477 9:127524049-127524071 AAATGGGTCTGCACGGATGCTGG - Intronic
1061047471 9:128174366-128174388 AAGTCACTGTGCAGGGAGGCTGG + Intronic
1061193129 9:129093832-129093854 AAGCGGGTAAAGAGGGAGGCTGG - Intergenic
1061403040 9:130378594-130378616 AGGCGGGGAGGCAGGGAGGCAGG + Intronic
1062243177 9:135550492-135550514 ATGCGGGTATGTGGGGAGGCCGG + Intergenic
1062403018 9:136380663-136380685 GAGTGGGTTTCCACGGAGGCTGG - Intronic
1062565822 9:137163522-137163544 AAGTGAGCCTGCAGTGAGGCGGG - Intronic
1185995473 X:4943836-4943858 AAATGGGTATCCAGGTAGTCAGG - Intergenic
1186029584 X:5353491-5353513 AAGAGAGAATGCAGAGAGGCTGG + Intergenic
1186567474 X:10679007-10679029 AAGTGGGATTGCTGGGAGGAAGG - Intronic
1187481012 X:19655665-19655687 AAGTGGGGAGGAAGGGAGGGGGG + Intronic
1189341522 X:40208040-40208062 AAGTAGGTAGGTAGGTAGGCAGG - Intergenic
1189445199 X:41074878-41074900 AGGTGGAGATGCAGAGAGGCAGG + Intergenic
1191786873 X:64925635-64925657 AAGTAGGCATGGAGGGAGGAGGG - Intronic
1191820928 X:65306996-65307018 AAGTGGGTATGGTGAGAGGCTGG + Intergenic
1192033865 X:67543944-67543966 AGGTGGGAAGGCAAGGAGGCCGG + Intergenic
1193203611 X:78721672-78721694 AAGGGGGAATGGTGGGAGGCGGG + Intergenic
1193320999 X:80121055-80121077 AAGTAGATATGGAGGGATGCAGG - Intergenic
1194524129 X:94956624-94956646 GAGTGGGGATGAAGAGAGGCTGG + Intergenic
1195330538 X:103795133-103795155 AAAGGGGTAGGCAGGGAGACAGG + Intergenic
1198394729 X:136209523-136209545 AACTGGTTATGCTGGGAGGTCGG + Intronic
1198500317 X:137238217-137238239 AAGTGGGTAGGCAGGAAGGGAGG - Intergenic
1199016275 X:142819702-142819724 AAGTGGCTATGCATGGACCCTGG - Intergenic
1199430700 X:147756679-147756701 AACTGTGTATGCAAGAAGGCTGG - Intergenic
1199868186 X:151873114-151873136 AAGTAGGAATGCAGGGTGGCAGG + Intergenic
1200082597 X:153585890-153585912 AAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1200140809 X:153902098-153902120 AAGAGTGGAGGCAGGGAGGCTGG - Intronic
1200834323 Y:7718121-7718143 AGGTGGGGAGGCTGGGAGGCAGG - Intergenic
1200909909 Y:8522706-8522728 AACTGGGTTTGCAGGGATGTGGG + Intergenic
1201438432 Y:13984951-13984973 AAGGTGGTATGCAGGGAGGGAGG - Intergenic
1201438622 Y:13985557-13985579 AAGTGTGTCAGGAGGGAGGCAGG - Intergenic
1201445951 Y:14057151-14057173 AAGTGTGTCAGGAGGGAGGCAGG + Intergenic
1201446141 Y:14057757-14057779 AAGGTGGTATGCAGGGAGGGAGG + Intergenic