ID: 1078525144

View in Genome Browser
Species Human (GRCh38)
Location 11:12095034-12095056
Sequence CTCAAACACATGTTGATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 585
Summary {0: 1, 1: 0, 2: 0, 3: 62, 4: 522}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078525140_1078525144 5 Left 1078525140 11:12095006-12095028 CCTACATTGTTCCCTCTTATGAT 0: 1
1: 0
2: 0
3: 12
4: 154
Right 1078525144 11:12095034-12095056 CTCAAACACATGTTGATGAAAGG 0: 1
1: 0
2: 0
3: 62
4: 522
1078525142_1078525144 -6 Left 1078525142 11:12095017-12095039 CCCTCTTATGATAGGAGCTCAAA 0: 1
1: 0
2: 0
3: 11
4: 130
Right 1078525144 11:12095034-12095056 CTCAAACACATGTTGATGAAAGG 0: 1
1: 0
2: 0
3: 62
4: 522
1078525143_1078525144 -7 Left 1078525143 11:12095018-12095040 CCTCTTATGATAGGAGCTCAAAC 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1078525144 11:12095034-12095056 CTCAAACACATGTTGATGAAAGG 0: 1
1: 0
2: 0
3: 62
4: 522

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078525144 Original CRISPR CTCAAACACATGTTGATGAA AGG Intronic
900752430 1:4407075-4407097 ACCCAACACATGTTGGTGAAAGG + Intergenic
900912184 1:5606308-5606330 CTCAAACCCATGTTGTTTGAGGG + Intergenic
902492251 1:16791828-16791850 TTCAAACCCATGTTGCTCAAGGG + Intronic
903410488 1:23139395-23139417 TTCAAACCCATGTTGTTCAAGGG - Intronic
905052642 1:35065113-35065135 TTCAAACTCATATTGTTGAAGGG - Intronic
905161212 1:36036154-36036176 CTTAAACACATTTTGAAAAAGGG - Intronic
906913191 1:49978910-49978932 TCCAAACCCATGTTGTTGAAGGG - Intronic
907020555 1:51062450-51062472 CTCAAACCCATGTTGTTCAAGGG + Intergenic
907042605 1:51276809-51276831 CTAAAACTGATGGTGATGAAAGG + Intergenic
907643430 1:56215879-56215901 TTCAAACCCATGTTGTTCAAGGG + Intergenic
907887809 1:58609799-58609821 TTCAAACCCATGTTGCTTAAGGG - Intergenic
908371689 1:63487298-63487320 TTCAAACCCATGTTGTTCAAGGG + Intronic
908579587 1:65500403-65500425 TTCAAACTCATGTTGTTTAAGGG - Intronic
910274790 1:85437339-85437361 TTCAAACCCATGTTGTTCAAGGG - Intronic
910412211 1:86958526-86958548 TTCAAACCCATGTTGTTCAAGGG + Intronic
910457896 1:87417432-87417454 TTCAAACCCATGTTGTTCAAGGG + Intergenic
910484285 1:87695337-87695359 TTCAAACCCATGTTGTTCAAGGG - Intergenic
910892050 1:92028772-92028794 TTCAAACACATGTTGTTTGAGGG - Intergenic
911266309 1:95748621-95748643 TTCAAACCCATGTTGTTCAAAGG - Intergenic
911812754 1:102304526-102304548 TTCAAACCCATGTTGTTCAAGGG - Intergenic
912500451 1:110118573-110118595 TTCAAACCCATGTTGTTCAAGGG + Intergenic
912840831 1:113037743-113037765 TTCAAACCCATGTTGTTCAAGGG - Intergenic
913088086 1:115457607-115457629 CTCAAAGCCATGTTGAAGGAGGG + Intergenic
913206848 1:116546799-116546821 CTCAAACCCATGTTGTTCAAGGG - Intronic
914315162 1:146503909-146503931 TTCAAACCCATGTTGTTCAAGGG + Intergenic
914329397 1:146652180-146652202 TTCAAACTCATGTTGTTCAAGGG + Intergenic
914499192 1:148229467-148229489 TTCAAACCCATGTTGTTCAAGGG - Intergenic
915635043 1:157180582-157180604 TCCAAACACATGTTCAGGAAGGG - Intergenic
915922925 1:159990634-159990656 CACAAACACAGATTGCTGAAAGG + Intergenic
916726873 1:167531520-167531542 TTCAAACTCATGTTGCTCAAGGG + Intronic
917381505 1:174414287-174414309 TTCAAACTCATGTTGTTCAAGGG + Intronic
917824478 1:178803006-178803028 TTCAAACCCATGTTGTTCAAGGG + Intronic
918271871 1:182909533-182909555 TTCAAACCCATGTTGTTCAAGGG - Intronic
918631285 1:186721845-186721867 CTCAAACACAAGATGATGTTGGG + Intergenic
919331056 1:196172351-196172373 TTCAAACTCATGTTGTTCAAGGG - Intergenic
919458989 1:197854505-197854527 TTCAAACCCATGTTGTTCAAGGG + Intergenic
919717462 1:200794243-200794265 TTCAAACTCATGTTGTTCAAGGG - Intronic
921387346 1:214583640-214583662 TTCAAACCCATGTTGTTCAAGGG - Intergenic
921812628 1:219531875-219531897 TTCAAACTCATGTTGTTCAAGGG - Intergenic
923093429 1:230756565-230756587 TTCAAACTCATGTTGTTAAAGGG - Intronic
923199791 1:231700193-231700215 CTCAAACCCGTGTTGTTCAAGGG - Intronic
923330465 1:232918872-232918894 TTCAAACCCATGTTGTTCAAGGG + Intergenic
923399813 1:233605948-233605970 CTCAAACTCATGTTGTTCAAAGG + Intergenic
923424594 1:233856173-233856195 CTCAAACCCATGTTGTTCAAGGG - Intergenic
923474838 1:234322620-234322642 TTCAAACCCATGTTGTTCAAGGG + Intronic
923528197 1:234790709-234790731 TTCAAACCCATGTTGCTCAAGGG - Intergenic
923977789 1:239283941-239283963 CTCAAAGCCATGTTGTTCAAGGG + Intergenic
1063085239 10:2811373-2811395 TTCAAACTCATGTTGTTCAAGGG + Intergenic
1063195468 10:3737650-3737672 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1063266016 10:4451749-4451771 CTCACATACATGTTGTTAAAGGG + Intergenic
1064159287 10:12929821-12929843 ATCAAACACATGTAAATGAGAGG + Intronic
1064576959 10:16756369-16756391 TTCAAACCCATGTTGCTCAAGGG - Intronic
1065150775 10:22820787-22820809 CTCAAGCACATAATGATCAATGG + Intergenic
1065446295 10:25805025-25805047 TTCAAACACATGTTGTTCAAGGG - Intergenic
1065506352 10:26433763-26433785 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1065606643 10:27425043-27425065 CTTAAACACATGCTTATGAAAGG + Intergenic
1065653256 10:27916476-27916498 CTCAAACCCATGTTATTCAAGGG - Intronic
1065794209 10:29291456-29291478 TTCAAACCCATGTTGTTCAAGGG + Intronic
1066011564 10:31199056-31199078 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1066340897 10:34532360-34532382 TTCAAACACAAGTTGTTCAAGGG + Intronic
1066648781 10:37636589-37636611 TTCAAACCCATGTTGTTCAAAGG + Intergenic
1067031674 10:42882287-42882309 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1068507134 10:57915262-57915284 CTCAAACCCATGTTATTCAAAGG + Intergenic
1068510005 10:57953727-57953749 CTCTAATATATGTTGATGACTGG + Intergenic
1068640099 10:59394631-59394653 CTCAAGCAAAAGTTGAGGAAAGG - Intergenic
1069023084 10:63511344-63511366 TTCAAACCCATGTTGTTTAAGGG - Intergenic
1069074478 10:64024005-64024027 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1069083464 10:64113299-64113321 CCAAAACACATTTTCATGAATGG - Intergenic
1069185062 10:65412001-65412023 GTCAAACTCATGTTGTTCAAAGG + Intergenic
1069243699 10:66174539-66174561 TTCAAACCCATGTTGTTCAAGGG - Intronic
1069327553 10:67250103-67250125 CTCAAACCCATGCTGTTCAAGGG - Intronic
1069677889 10:70261510-70261532 TTCAAACCCATGTTGTTCAAGGG + Intronic
1070061451 10:72987322-72987344 TTCAAACCCATGTTGTTTAAGGG + Intergenic
1070286863 10:75089974-75089996 TTCAAACACAGGTAGATGGAGGG - Intergenic
1070367175 10:75748982-75749004 TTCAAACCCATGTTGTTTAAGGG - Intronic
1070578756 10:77702634-77702656 TTCAAACCCATGTTGTTTAAAGG - Intergenic
1071018540 10:81025991-81026013 CATAAAAACATGTTGATCAATGG + Intergenic
1071021983 10:81068399-81068421 GTGGAAAACATGTTGATGAAAGG + Intergenic
1071174052 10:82902747-82902769 TTCAAACCCATGTTGTTCAAGGG - Intronic
1071944324 10:90624513-90624535 CTAAAACACATGTAGATTAAAGG + Intergenic
1072687199 10:97544993-97545015 CTCGAACCCATGTTGTTCAAGGG + Intronic
1072730971 10:97846550-97846572 AACAAATAGATGTTGATGAATGG + Intergenic
1074589734 10:114801445-114801467 TTCAAACCCATGTTGTTTAACGG + Intergenic
1074593219 10:114834804-114834826 TTCAAACCCATGTTGTTCAAGGG - Intronic
1074676477 10:115856908-115856930 TTCAAACCCATGTTGTTCAAGGG - Intronic
1074969614 10:118525253-118525275 TTCAAACTCATGTTGTTCAAGGG + Intergenic
1075749483 10:124753676-124753698 TTCAAACCCATGTTGTTCAAGGG - Intronic
1075833642 10:125433555-125433577 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1077812463 11:5652176-5652198 CAAAAACAAATGTTGACGAATGG - Intergenic
1078434409 11:11312594-11312616 TTCAAACCCATGTTGTTCAAGGG + Intronic
1078525144 11:12095034-12095056 CTCAAACACATGTTGATGAAAGG + Intronic
1078906123 11:15689489-15689511 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1078912459 11:15745740-15745762 CTCAAATCCATGTTGATCAATGG - Intergenic
1078960308 11:16259623-16259645 CTCAAAGACATTATGATGAGTGG + Intronic
1079227843 11:18623225-18623247 TTCAAACCTATGTTGTTGAAGGG + Intronic
1079995386 11:27290149-27290171 CTCAAACACATTTTAAAGAATGG + Intergenic
1080221010 11:29904207-29904229 CTCAAATCCATGTTGTTCAATGG - Intergenic
1081922070 11:46787805-46787827 TTCAAACCCATGTTGTTCAAGGG - Intronic
1082232951 11:49791590-49791612 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1082730922 11:56796517-56796539 TTCAAACCCATGTTGTTCAAAGG + Intergenic
1082896816 11:58200653-58200675 CTCACTCACATGTTGGTGACTGG + Intergenic
1083370675 11:62177120-62177142 TTCAAACCCATGTTGCTCAAGGG - Intergenic
1084702039 11:70793163-70793185 TTCAAACCCATGTTGTTCAAGGG - Intronic
1085681378 11:78578207-78578229 CTGAAACCCATGTTGTTCAAGGG - Intergenic
1086344528 11:85882807-85882829 CACAAACACATGTAGGTAAATGG + Intronic
1086617676 11:88842324-88842346 TTCAAACTCATGTTGTTCAAGGG + Intronic
1087252533 11:95919187-95919209 CTAAAACACATTTTGTTGCAAGG - Intronic
1088028853 11:105221366-105221388 CTAAAGCACATGTTGATGGGAGG + Intergenic
1088052798 11:105538835-105538857 CTCAAACACATGCTGTGGAAAGG + Intergenic
1088162749 11:106893300-106893322 ATCAAAAACATGTTGGTTAAAGG + Intronic
1088544036 11:110942016-110942038 TTCAAACCCATGTTGCTCAAAGG + Intergenic
1088895270 11:114073747-114073769 GTCACAGACATTTTGATGAAGGG + Intronic
1089029617 11:115311582-115311604 TTCAAACACATGTTGTTCAAGGG + Intronic
1089545867 11:119224962-119224984 TTCAAACCCATGTTGTTGAAGGG + Intronic
1089576289 11:119446741-119446763 CTCTAAAGCATGCTGATGAAAGG - Intergenic
1090685503 11:129113685-129113707 TTCAAACCCATGTTGTTCAAGGG + Intronic
1092111797 12:5969649-5969671 CTCAAACCAATGCTGAGGAAGGG - Intronic
1092518530 12:9241393-9241415 CCCAACCACAAGTTTATGAAGGG + Intergenic
1092551095 12:9500980-9501002 TTCACACACATGTTGATGGATGG + Intergenic
1093204297 12:16228554-16228576 TTCAAACCCATGTTGTTCAAGGG - Intronic
1093532239 12:20180691-20180713 ATTAAACACATTTTGATAAAAGG + Intergenic
1093682573 12:22019699-22019721 TTCAAACACATGCTGCTCAAAGG - Intergenic
1093957038 12:25232120-25232142 CTCAAACGCATGTTGTTCAAGGG + Intronic
1094520721 12:31185399-31185421 TTCACACACATGTTGATGGATGG - Intergenic
1095120165 12:38407594-38407616 TTCAAACGCATGTTGTTCAAGGG - Intergenic
1095253431 12:40005027-40005049 TTCAAACCCATGTTGTTGGAGGG + Intronic
1095610410 12:44121326-44121348 TTCAAACCCATGTTGTTCAATGG - Intronic
1095769874 12:45941797-45941819 TTCAAACACATGTTGTTCAAGGG - Intronic
1096568765 12:52505676-52505698 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1097533886 12:60840406-60840428 CTCAATCACATGTTGCTTAAGGG - Intergenic
1097564081 12:61246484-61246506 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1097830053 12:64214907-64214929 TTCCAACACATGTTAAAGAATGG + Intronic
1098353738 12:69590067-69590089 TTCAAACCCATGTTGTTCAATGG - Intronic
1098701993 12:73640165-73640187 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1098869386 12:75800217-75800239 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1098876081 12:75867621-75867643 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1099602073 12:84752918-84752940 CGCATCCACATGTTTATGAATGG - Intergenic
1099999384 12:89814657-89814679 TTCAAACCCATGTTGTTTAAGGG - Intergenic
1100518544 12:95351584-95351606 CTCAAACACATGGCAATGAGAGG + Intergenic
1100730041 12:97454995-97455017 CTCAAACCCAAGTTGTTCAATGG - Intergenic
1100753142 12:97721402-97721424 ATTATACACATGTTGAAGAAGGG + Intergenic
1101009259 12:100432027-100432049 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1101367610 12:104089561-104089583 TTCAAACTCATGTTGTTGAAGGG + Intronic
1102268523 12:111508884-111508906 CTAAAACACAGGCTGAGGAAAGG + Intronic
1102938019 12:116913746-116913768 TTCAAACCCATGTTGTTCAAGGG + Intronic
1103985585 12:124765306-124765328 CTCAAACATCTGTTCCTGAAAGG + Intergenic
1104184403 12:126415870-126415892 GTCAAACCCATGTTGTTCAAGGG - Intergenic
1104982228 12:132578533-132578555 TTCAAACCCATGTTGTTCAAGGG + Intronic
1105394178 13:20012711-20012733 CACCACCACCTGTTGATGAAGGG + Intronic
1105398643 13:20066730-20066752 TTCAAACCCATGTTGCTCAAGGG + Intronic
1106218532 13:27724723-27724745 CTCAAAAACTAGTTGTTGAATGG - Intergenic
1106653742 13:31719863-31719885 CCCAAACAGATGATGATGGAAGG + Intergenic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1108450105 13:50553333-50553355 TTCAAACTCATGTTGCTTAAGGG - Intronic
1108467382 13:50730281-50730303 CTCAAACCCATGTTGTTCAAGGG + Intronic
1108961079 13:56230452-56230474 GTCAAACCCATGTTGTTCAAGGG + Intergenic
1109048306 13:57441567-57441589 TTCAAACCCATGTTGTTCAAAGG + Intergenic
1109200066 13:59420461-59420483 TTCAAACACATGTTGTTCAAGGG + Intergenic
1109338160 13:61019173-61019195 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1109921884 13:69074667-69074689 TTCAAACTGATGTTGTTGAAGGG + Intergenic
1110143996 13:72167513-72167535 AGCAAACACATGGTGATGGATGG - Intergenic
1110442521 13:75541184-75541206 TTCAAACCCATGTTGTTCAAGGG + Intronic
1110563312 13:76932740-76932762 TTCAAACTCATGTTGTTCAAGGG + Intergenic
1111424462 13:88061196-88061218 CTCAAACTCATGTTATTCAAGGG - Intergenic
1111502923 13:89147581-89147603 TTCAAACCCATGTTGTTAAAGGG - Intergenic
1111633140 13:90868915-90868937 ATCAAACCCATGTTGTTCAAGGG + Intergenic
1111771933 13:92607823-92607845 TTCAAACCCATGTTGTTCAAGGG - Intronic
1111852741 13:93597520-93597542 TTCAAACATATGTTGCTCAAGGG - Intronic
1112096646 13:96139906-96139928 TTCAAACCCATGTTGTTTAAGGG - Intronic
1112232119 13:97599582-97599604 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1112400666 13:99075320-99075342 TTCAAACCCATGTTGTTCAAAGG + Intronic
1112688968 13:101867380-101867402 CTGATACATATGTTGATGACAGG - Intronic
1113358192 13:109602995-109603017 TTCAAACACGTGTTGTTGAAGGG - Intergenic
1113710523 13:112461553-112461575 CTCCAAAACATGGGGATGAAAGG + Intergenic
1114480527 14:23031051-23031073 TTCAAACCCATGTTGCTCAAGGG + Intronic
1114775032 14:25472300-25472322 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1115578475 14:34734512-34734534 TTCAAACCCATGTTGCTCAAAGG + Intergenic
1116273476 14:42801629-42801651 CTCAAATATATGTTTCTGAAAGG + Intergenic
1116499665 14:45605442-45605464 TTCACACACATGTTGATGTATGG + Intergenic
1116564118 14:46423224-46423246 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1117425601 14:55592448-55592470 TTCAAACCCATGTTGTTCAAGGG - Intronic
1117683902 14:58233337-58233359 TTCAAACCCATGTTGTTCAAGGG - Intronic
1117923684 14:60753281-60753303 TTCAAACTCATGTTGTTTAATGG - Intronic
1118120492 14:62835210-62835232 CACATACACATGTTGGTAAATGG - Intronic
1118168944 14:63366293-63366315 TTCAAACCCATGTTGTTCAATGG - Intergenic
1120319818 14:82945212-82945234 TTGAAACACATGTTGTTCAAAGG + Intergenic
1121877451 14:97466428-97466450 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1122185541 14:99990960-99990982 TTCAAACCCATGTTGTTCAAGGG - Intronic
1122391496 14:101390619-101390641 CTCAAACCCATGTTGGTCAAGGG - Intergenic
1123454311 15:20405405-20405427 CTCAAACCTATGTTGTTAAAGGG - Intergenic
1124506435 15:30279858-30279880 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1124639596 15:31389021-31389043 TTCAAACCCATGTTGTTCAATGG - Intronic
1124737122 15:32258778-32258800 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1124833649 15:33174576-33174598 ATCAAAAAAATGTTGATGATTGG - Intronic
1125160283 15:36635335-36635357 TTCAAACCCATGTTGTTCAAGGG - Intronic
1125311488 15:38383617-38383639 CTCAAACCCATGTTGTTCAAGGG - Intergenic
1126330835 15:47529398-47529420 TTCAAACCCGTGTTGTTGAAGGG + Intronic
1126342362 15:47655066-47655088 TTCAAACCCATGTTGTTCAAAGG + Intronic
1126584625 15:50271460-50271482 CTTAAATATATGTTGAGGAATGG - Intergenic
1126718779 15:51553517-51553539 TTCAAACCCATGTTATTGAAGGG - Intronic
1127079976 15:55368049-55368071 TTCAAACTCATGTTGCTCAAGGG - Intronic
1127101876 15:55574615-55574637 TTCAAACCCATGTTGTTCAAAGG + Intronic
1127431617 15:58915581-58915603 CTCAAACACAAGCTGATTACAGG + Intronic
1127747826 15:61998746-61998768 TTCAAACCCATGTTGTTCAAGGG - Intronic
1129625812 15:77197798-77197820 TTCAAACCCATGTTGTTCAAGGG - Intronic
1131077785 15:89506817-89506839 CTCAAACCTATGTTGTTAAAGGG - Intergenic
1131324072 15:91425634-91425656 TTGAAACACATGCTGATGTAGGG + Intergenic
1131409337 15:92193297-92193319 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1131623942 15:94098030-94098052 TTCAAACACATGTTCTTCAAGGG - Intergenic
1131930044 15:97431720-97431742 CTCAAACATATTTTTCTGAATGG - Intergenic
1134139638 16:11706856-11706878 TTCAAACCCATGTTGTTCAAGGG - Intronic
1134331242 16:13252874-13252896 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1135532079 16:23263461-23263483 TTCAAACCCATGTTGTTTAAGGG - Intergenic
1136462782 16:30422200-30422222 CTCAAACCCGTGTTGTTCAAGGG + Intronic
1137941405 16:52691142-52691164 TTCAAACTCATGTTGTTTAAGGG - Intergenic
1138203392 16:55106596-55106618 CTCAAGCACAAGCTGAGGAAAGG + Intergenic
1138772549 16:59683200-59683222 CTCACACTCATGTTACTGAATGG + Intergenic
1139321646 16:66119121-66119143 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1140004164 16:71058754-71058776 TTCAAACTCATGTTGTTCAAGGG - Intronic
1140248176 16:73270273-73270295 CTCAAATTCATGTTGAAGACAGG + Intergenic
1140450448 16:75066428-75066450 CTCAATAAAATATTGATGAAGGG + Intronic
1142360323 16:89623109-89623131 CTCAAAAACATGTTTAGGGAAGG - Intronic
1142479817 17:212323-212345 CTCACACACCTGATGCTGAACGG - Intergenic
1143677756 17:8448718-8448740 TTCAAACCCATGTTGTTCAAGGG - Intronic
1143762052 17:9111928-9111950 TTCAAACCCATGTTGTTCAATGG + Intronic
1144355934 17:14446295-14446317 CTAAAACACATTTTGAAGATAGG + Intergenic
1146246812 17:31292607-31292629 TTCAAACCCATGTTGTTCAAGGG + Intronic
1146509296 17:33432084-33432106 CTCAACCTCATGTTGTTCAAGGG - Intronic
1146541260 17:33697431-33697453 TTCAAACTCATGTTGTTCAAGGG + Intronic
1146754644 17:35418291-35418313 TTCAAACCCATGTTGTTCAAGGG - Intronic
1148576425 17:48714769-48714791 CTCACAGACATTTTGTTGAATGG + Intergenic
1148880871 17:50725609-50725631 CTCAAACCCGTGTTGTTCAAGGG - Intronic
1148929775 17:51119323-51119345 CTTAAATACATGGTGATCAAAGG - Intronic
1149165756 17:53750046-53750068 TTCAAACCCATGTTGTTCAAAGG - Intergenic
1149250074 17:54758001-54758023 TTCAAACTCATGTTGTTCAAGGG + Intergenic
1149944942 17:60914581-60914603 TTCAAACCCATGTTGTTCAATGG - Intronic
1150719294 17:67600893-67600915 CTCAAATATACGTTGATGTAAGG - Intronic
1151295938 17:73186209-73186231 TTTAAACACGTGTTGCTGAAAGG - Intergenic
1151860850 17:76760462-76760484 TTCAAACCCATGTTGTTCAAGGG + Intronic
1152007630 17:77692527-77692549 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1153072261 18:1118852-1118874 CAAAAACAAATGTTGATAAATGG - Intergenic
1153369525 18:4298297-4298319 GTCAAACCCATGTTGTTCAAGGG + Intronic
1153499706 18:5735893-5735915 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1153659404 18:7313899-7313921 TTCCAACCCATGTTGTTGAAGGG + Intergenic
1153734040 18:8045831-8045853 CTCAAAAAGATGTTGAAAAAAGG + Intronic
1154357917 18:13636364-13636386 TTTAAACACATGTTGTTCAACGG + Intronic
1155706883 18:28826583-28826605 CACAAACACATGTTTATAAAAGG - Intergenic
1155717346 18:28961463-28961485 TTCAAAAACATGTTGAGCAAGGG - Intergenic
1156216847 18:35007776-35007798 TTCAAACCCATGTTGTTCAAGGG - Intronic
1156579502 18:38358784-38358806 TTCAAACCCATGCTGTTGAAGGG + Intergenic
1156656487 18:39294551-39294573 CCAAAACACATGTGGATCAAAGG + Intergenic
1157904118 18:51552173-51552195 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1158129424 18:54136400-54136422 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1158532383 18:58275384-58275406 CTCAAACCCATCTTGTTCAAGGG + Intronic
1159400603 18:67928017-67928039 TTCAAACACATGTTGTTCAAGGG + Intergenic
1159751746 18:72311263-72311285 TTCAAACCCATGTTGTTTAAGGG + Intergenic
1160165597 18:76508268-76508290 CTCAAACAAAACTTGGTGAAAGG - Intergenic
1160490371 18:79332693-79332715 TTCAAACCCATGTTGTTTAAGGG + Intronic
1161485481 19:4533409-4533431 TTCAAACCCATGTTGTTGAAGGG + Intronic
1163163890 19:15482184-15482206 GTCAAACCCATGTTGTTCAAGGG - Intronic
1163295689 19:16411006-16411028 CTCAAAAACATGATGCTGAGTGG + Intronic
1164922387 19:32098435-32098457 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1167401041 19:49269608-49269630 CTCAAACTCATATTGTTCAATGG - Intergenic
1167810373 19:51824550-51824572 CTCAAAGAGATGTTGTTAAATGG + Exonic
1168366242 19:55790356-55790378 ATGAAACACATGTAGATGAATGG + Intronic
925495457 2:4443840-4443862 TTCAAACTCATGTTGTTCAAGGG + Intergenic
925820387 2:7794104-7794126 CTCAAATCCATGTGGATTAATGG - Intergenic
925937455 2:8778484-8778506 CTGAAACACATGAAGCTGAAAGG + Intronic
926662866 2:15487547-15487569 TTCAAACCCATGTTGCTGTAGGG + Intronic
926855218 2:17248982-17249004 CTCATACACATTTTTATGTATGG + Intergenic
927021911 2:19025878-19025900 CTCAAACACATGTTCTTTATGGG - Intergenic
927370921 2:22354445-22354467 TTCAAACCCATGTTGTTCAAGGG - Intergenic
927524641 2:23726615-23726637 TTCAAACCCATGTTGTTCAAGGG + Intergenic
927541603 2:23916846-23916868 CCTAAACAAATGTAGATGAAAGG + Intronic
928011648 2:27613732-27613754 TTCAAACTCATGTTGTTCAAGGG + Intronic
928822714 2:35381342-35381364 TTCAAACCCATGTTGTTCAAGGG + Intergenic
928850748 2:35742595-35742617 CTCAAACCCATGTTATTAAAGGG + Intergenic
929094800 2:38253167-38253189 TTCAAACCCATGTTGTTCAAGGG + Intergenic
929845636 2:45522581-45522603 TTCAAACCCATGTTGTTCAAGGG - Intronic
930458996 2:51645711-51645733 CAAAAACACATATTCATGAAAGG + Intergenic
931022011 2:58056636-58056658 CTCAAACACGTGATGCAGAATGG - Intronic
931029935 2:58162450-58162472 TTCAAACCCATGTTGTTCAAGGG - Intronic
931049254 2:58392263-58392285 CACTAACACATGTTGATCAAAGG - Intergenic
931162402 2:59706264-59706286 TTCAAACCCATGTTGTTCAAGGG - Intergenic
931682345 2:64761427-64761449 AACAAACACTTGTTGAGGAAAGG + Intergenic
932576826 2:72966966-72966988 CTCAAACACAGGCTGATTGAGGG + Intronic
932864095 2:75323577-75323599 TTCAAACCCATGTTGTTCAAGGG - Intergenic
932955010 2:76341432-76341454 TTCAAACCCATGTTGTTCAAGGG + Intergenic
933830683 2:86205535-86205557 TTCAAACCCATGTTGTTCAAGGG + Intronic
933857888 2:86435187-86435209 CTCAAAAACATGTTGAGTAAAGG + Intergenic
934719506 2:96563740-96563762 TTCAAACCCATGTTGTTCAAGGG + Intergenic
935323774 2:101915497-101915519 TTCAAACACATGTTGTTCAAGGG - Intergenic
937182038 2:120005435-120005457 CTCAAACACATTTTGGAAAATGG + Intergenic
937383967 2:121408822-121408844 CTAAAACAGATGTACATGAAAGG + Intronic
937777613 2:125798413-125798435 TTCAAACCCATGTTGTTCAAGGG + Intergenic
938217398 2:129531786-129531808 CTCAAGCACAACTTGTTGAAAGG + Intergenic
939223319 2:139332545-139332567 TTCAAACCCATGTTGTTCAAAGG + Intergenic
939230585 2:139420730-139420752 CCCAAACACATCTTGAGAAATGG - Intergenic
939338234 2:140859191-140859213 CTCAAAAACATGTTGCAGCATGG - Intronic
939723502 2:145684747-145684769 TTCAAACCCATGTTGTTCAAGGG - Intergenic
939749565 2:146026449-146026471 TTCAAACCCATGTTGTTCAAGGG - Intergenic
940477379 2:154180876-154180898 TTCAAACTCATGTTGTTCAAGGG - Intronic
941165045 2:162075021-162075043 CTCAAACATCTGTGGATGACTGG - Intergenic
941642785 2:168007378-168007400 CTCTAACAAATGTTTATGGAGGG + Intronic
942344309 2:174986544-174986566 TTCAAACCCATGTTGTTTAAGGG - Intronic
942468958 2:176239898-176239920 CTCAGGCACATGTAGATGGAAGG + Intergenic
942897353 2:181073329-181073351 TTCAAACCCGTGTTGTTGAAGGG - Intronic
944658897 2:201903847-201903869 TTCAAACCCATGTTGTTCAAGGG + Intergenic
945971560 2:216236276-216236298 TTCAAACTCATGTTGTTCAAGGG + Intergenic
946677936 2:222182217-222182239 TTCAAACCCATGTTGTTCAAGGG - Intergenic
948342539 2:237266346-237266368 TTCAAACCCATGTTGTTCAAGGG - Intergenic
948451158 2:238073669-238073691 TTCAAACCCATGTTGTTCAAGGG - Intronic
948540603 2:238689254-238689276 CACAGTCAAATGTTGATGAATGG + Intergenic
1168908470 20:1426000-1426022 TTCAAACACGTGTTGTTTAAGGG + Intergenic
1169058788 20:2645416-2645438 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1169202877 20:3722319-3722341 TTCAAACCCATGTTGTTTAAGGG - Intergenic
1169777561 20:9272674-9272696 CTCAAAAACAATTTGATTAATGG - Intronic
1169894307 20:10486068-10486090 TTCAAACTCATGTTGTTCAAGGG + Intronic
1170602744 20:17854151-17854173 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1170903407 20:20488190-20488212 TTCAAACCCATGTTGCTGAAAGG + Intronic
1171418111 20:24997333-24997355 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1172760768 20:37319857-37319879 TTCAAACCCATGTTGCTCAAGGG - Intergenic
1172857095 20:38013552-38013574 CTTTCACACATGTTGAAGAAAGG + Exonic
1172922934 20:38501735-38501757 TTCAAATACATGTTGTTCAATGG - Intronic
1172945666 20:38686667-38686689 CTCAAAAACATGTTAATCAGAGG + Intergenic
1173289888 20:41705382-41705404 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1173342799 20:42168264-42168286 TTCAAACCCATGTTGTTCAAGGG + Intronic
1174234730 20:49080065-49080087 CTCAAACCCGTGTTGTTCAAGGG + Intronic
1177345534 21:19863715-19863737 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1177550480 21:22614759-22614781 TTCAAACTCGTGTTGTTGAAGGG + Intergenic
1178018498 21:28380057-28380079 ATCAAACACATGATGATTAATGG + Intergenic
1179345909 21:40557079-40557101 TTCAAACCCATGTTGTTGAAGGG + Intronic
1182404233 22:30110747-30110769 CTCAAACCCATGTTGTTCAAAGG - Intronic
1182726070 22:32446803-32446825 CTCACACAGAGGTTGAAGAATGG - Intronic
1183016025 22:34987911-34987933 ATAAAATACATGTTTATGAATGG - Intergenic
949160636 3:877724-877746 TTTATACACATGTTGATGAAAGG + Intergenic
949443731 3:4111317-4111339 TTCAAACCCATGTTGTTCAAGGG + Intronic
949522058 3:4866442-4866464 TTCAAACCCATGTTGTTCAAGGG + Intronic
950997703 3:17521212-17521234 TTCAAACCCATGTTGTTCAAGGG - Intronic
951015159 3:17723579-17723601 TTCAAACCCATGTTGTTCAAGGG - Intronic
951170518 3:19536687-19536709 TTCAAACCCATGTTGTTGAAGGG + Intergenic
951959168 3:28295922-28295944 CTCAAACCCATGTTGTTCAAGGG + Intronic
952563963 3:34633297-34633319 TTCAAACTCATGTTGTTTAAGGG - Intergenic
953866306 3:46586101-46586123 TTCAAACATATGTTGCTCAAGGG + Intronic
953938248 3:47065981-47066003 TTCAAACTCATGTTGTTCAAGGG - Intronic
955425862 3:58788986-58789008 TTCAAACCCATGTTGTTCAAGGG + Intronic
955504959 3:59622964-59622986 TTCAAACTCATGTTGTTCAAGGG + Intergenic
956794523 3:72705654-72705676 TTCAAACCCATGTTGTTCAAGGG - Intergenic
957274412 3:78072568-78072590 CTCACAAAACTGTTGATGAAAGG + Intergenic
957347845 3:78984837-78984859 TTCAAACTCATGTTGTTTAAGGG - Intronic
957635699 3:82780994-82781016 ATTAAACCAATGTTGATGAAAGG + Intergenic
958112485 3:89166394-89166416 CTAAAACACATGGAGAGGAAGGG + Intronic
958126779 3:89366349-89366371 TTTAAACACATGTGGAAGAAAGG + Intronic
959674043 3:109014352-109014374 CTCAACAAAATGTTGATGATTGG + Intronic
959771027 3:110096569-110096591 GTAAAACACATGTTGGTTAAAGG - Intergenic
959979455 3:112499018-112499040 CTTAAAAACATGTTGATGGTAGG - Intronic
960004619 3:112769332-112769354 TTCAAACCCATGTTGTTCAAGGG + Intronic
960077581 3:113505233-113505255 CTCAAACTCATGTTGTTCAAAGG + Intronic
960268101 3:115644384-115644406 TTCAAACACTGGTTGATAAAAGG + Intronic
962347923 3:134634648-134634670 TTCAAACCCATGTTGTTCAAGGG - Intronic
962523305 3:136216732-136216754 TTCAAACCCATGTTGTTCAAGGG - Intergenic
962551666 3:136499146-136499168 TTCAAACCCATGTTGTTCAAAGG + Intronic
962660004 3:137592194-137592216 CACAAAAACTTGTTCATGAATGG + Intergenic
963190016 3:142459595-142459617 TTCAAACTCATGTTGTTCAAGGG - Intronic
963810269 3:149769907-149769929 TTCAAACTCATGTTGTTCAAAGG - Intronic
963982240 3:151551533-151551555 TTCAAACTCATGTTGTTCAAGGG + Intergenic
964372531 3:156015945-156015967 TTCAAACCCATGTTGTTTAAGGG + Intergenic
964592548 3:158380896-158380918 TTTAAACACATGTTGTTTAAGGG - Intronic
964956444 3:162363818-162363840 TTCAAACCCATGTTGTTCAAAGG - Intergenic
965348658 3:167585472-167585494 CTTAATCACCTGTTGATTAAAGG - Intronic
966370954 3:179250239-179250261 TTCAAACCCATGTTGTTCAAAGG + Intronic
966981486 3:185140196-185140218 TTCAAACCCATGTTGTTCAAGGG + Intronic
968322725 3:197785407-197785429 TTCAAAGCCATGTTGTTGAAGGG + Exonic
970156430 4:13146069-13146091 TTCAAACCCATGTTGATCAACGG - Intergenic
970898758 4:21134124-21134146 TTCAAACCCATGTTGTTCAAAGG - Intronic
971084159 4:23250717-23250739 GTCAAACTCATGTTGTTTAAGGG + Intergenic
972362676 4:38342853-38342875 TTCAAACCGATGTTGTTGAAGGG - Intergenic
973061279 4:45729004-45729026 TTCAAATACATGTTGTTCAAGGG - Intergenic
973064129 4:45766249-45766271 TTCAAACACATATTGTTCAAGGG - Intergenic
974536134 4:63178340-63178362 TTCAAACCCATGTTGTTTAAGGG + Intergenic
975527089 4:75362713-75362735 CTCAAACCCATGTTGTTCAAGGG + Intergenic
977317614 4:95470326-95470348 TTCAAACGCATGTTGTTCAAGGG + Intronic
977337578 4:95718020-95718042 TTCAAACCCATGTTGTTCAAGGG - Intergenic
977552698 4:98458804-98458826 TTCAAACCCATGTTGTTCAAGGG - Intergenic
977552725 4:98459041-98459063 TTCAAACCCATGTTGTTCAAGGG + Intergenic
977601252 4:98936056-98936078 TTCAAACACGTGTTGTTCAAGGG - Intergenic
977878392 4:102176013-102176035 TTCAAACCCATGTTGTTCAAGGG - Intergenic
978723344 4:111941039-111941061 CCCAAACACATGGTGATGCTGGG + Intergenic
978935597 4:114371316-114371338 TTCAAACCCATGTTGTTCAAAGG - Intergenic
979144955 4:117235192-117235214 TTCAAACTCATGTTGTTCAAGGG - Intergenic
979943724 4:126797811-126797833 TTCAAACTCATGTTGTTCAAGGG + Intergenic
980986403 4:139699665-139699687 TTCAAACCCATGTTGTTCAAGGG + Intronic
981092421 4:140745375-140745397 TTCAAACCCATGTTGTTTAAAGG - Intronic
981267630 4:142805493-142805515 TTCAAACCCATGTTGCTCAAGGG - Intronic
981357563 4:143807582-143807604 CTAAAACACATAATGATGTATGG - Intergenic
981369029 4:143937129-143937151 CTAAAACACATAATGATGTATGG - Intergenic
981378772 4:144047064-144047086 CTAAAACACATAATGATGTATGG - Intergenic
981498724 4:145423209-145423231 CTCAAACCCATGTTGTTCAAGGG + Intergenic
982473930 4:155827211-155827233 TTCAAACCCATGTTGTTCAAAGG - Intergenic
982591214 4:157314128-157314150 TTCAAACCCATGTTGTTCAAGGG + Intronic
982837383 4:160137321-160137343 CTCAAACCCGTGTTGTTCAAGGG + Intergenic
984251387 4:177339644-177339666 TTCAAACCCATGTTGTTCAAAGG + Intronic
984321605 4:178204242-178204264 CTAAAACACAGGTTGTTAAAGGG + Intergenic
984423805 4:179558286-179558308 TTCAAACCCATGTTGTTCAAGGG + Intergenic
984911165 4:184675871-184675893 CTCAAACCCTTGTTGTTCAAGGG + Intronic
984984422 4:185314103-185314125 CTCAAACTCATGTTGCTCAAGGG + Intronic
985192014 4:187384657-187384679 TTCAAACCCATGTTGTTCAAGGG + Intergenic
985307318 4:188557760-188557782 TTCAAACCCATGTTGTTTAAGGG - Intergenic
986874815 5:12095105-12095127 TTCAAACCCATGTTGTTCAACGG - Intergenic
988118685 5:26930540-26930562 TTCAAACCCATGTTGTTCAAGGG + Intronic
988750304 5:34185719-34185741 CGCAAACACATGACTATGAAAGG + Intergenic
988822478 5:34901286-34901308 TTCAAACCCATGTTGTTCAAGGG + Intergenic
989352668 5:40504379-40504401 TTCAAACCCATGTTGTTCAAGGG + Intergenic
989499559 5:42149818-42149840 CTCACAAACATACTGATGAAAGG - Intergenic
989650078 5:43678264-43678286 CTCAAACCCATGTTGTTCAAGGG + Intronic
990364580 5:55057192-55057214 TTCAAACGCATGTTGTTCAAGGG + Intergenic
991098380 5:62763786-62763808 TTCAAACCCATGTTGTTCAAGGG + Intergenic
991415861 5:66392308-66392330 CCCAAACTCATGTTGACAAAGGG + Intergenic
991954546 5:71979846-71979868 TTCAAACCCATGTTGTTCAAGGG - Intergenic
992273141 5:75086595-75086617 CCAAAACCCATTTTGATGAAGGG + Intronic
993020565 5:82585504-82585526 TTCAAACCCATGTTGTTTAAGGG - Intergenic
993334168 5:86636061-86636083 CACAAAAACATGTTTATGTATGG - Intergenic
993970404 5:94412796-94412818 TTCAAACCCATGTTGTTCAAGGG - Intronic
994922273 5:106062520-106062542 TTCAAACCCATGTTGTTCAAGGG - Intergenic
994938376 5:106286473-106286495 TTCAAACACATGTTCTTCAAGGG - Intergenic
995217340 5:109611086-109611108 TTCAAACCCATGTTGTTCAAGGG - Intergenic
995534992 5:113126449-113126471 CTCAAATACATGTTGTTCAAAGG - Intronic
995830741 5:116352633-116352655 TTCAAACTCATGTTGACCAAGGG + Intronic
996215524 5:120860721-120860743 TTCAAACCCATGTTGTTCAAGGG - Intergenic
996372584 5:122769109-122769131 TTCAAACCCATGCTGTTGAAGGG + Intergenic
996988525 5:129598984-129599006 TTCAAACCCATGTTGTTCAAGGG + Intronic
996999984 5:129747975-129747997 CTCACACACATGTACATGGAGGG - Intergenic
997132016 5:131286551-131286573 TTCAAACCCATGTTGTTCAAGGG - Intronic
998296700 5:140977152-140977174 ATCAAACTCATTTTGCTGAAAGG - Intronic
998510133 5:142706302-142706324 TTCAAACCCATGTTGTTCAAGGG + Intergenic
999412475 5:151364339-151364361 TTCAAACCCATGTTGTTCAAGGG + Intergenic
999775047 5:154805499-154805521 TTCAAACCCATGTTGTTCAAGGG + Intronic
1000512593 5:162202344-162202366 CTTAAACTCATGTTGTTCAAGGG + Intergenic
1000830505 5:166095813-166095835 CACAGACATATGCTGATGAAGGG - Intergenic
1000947699 5:167441712-167441734 TTCATACGTATGTTGATGAAGGG + Intronic
1001345045 5:170887054-170887076 TTCAAACTCATGTTGTTCAAGGG + Intronic
1001466967 5:171976032-171976054 CTAAAACACATGAGGATGGAAGG + Intronic
1001663531 5:173413893-173413915 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1002470865 5:179435312-179435334 CTCAAACACACGGTGCTGAGTGG + Intergenic
1002817089 6:691275-691297 TTCAAACCCATGTTGCTTAAGGG - Intronic
1002842344 6:917043-917065 CTCAAACTCATGTTGTTCAACGG - Intergenic
1002952545 6:1829218-1829240 TTCAAACCCATGTTGTTCAAGGG + Intronic
1003105953 6:3216104-3216126 GTCAAACCCATGTTGTTTAAGGG + Intergenic
1003232528 6:4267598-4267620 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1003765507 6:9231773-9231795 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1003804527 6:9712243-9712265 CTCAAAAACTTGCTGATGAGTGG - Intronic
1004834175 6:19512372-19512394 TTCAAACTCATGTTGTAGAAAGG - Intergenic
1005204525 6:23386513-23386535 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1006236748 6:32639977-32639999 GTCAAAAACATGTTGATGAGAGG + Intronic
1007755895 6:44099274-44099296 CTCCAAGACATATTGTTGAATGG - Intergenic
1007806503 6:44453914-44453936 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1008216000 6:48789524-48789546 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1008601870 6:53104298-53104320 CTCAACCACAGTTTGATGGAGGG - Intergenic
1009439322 6:63657711-63657733 TTCAAACCCATGTTGTTCAAGGG + Intronic
1009504221 6:64454492-64454514 ATCAAACTCATGTTGTTCAAGGG - Intronic
1009807259 6:68616670-68616692 TTCAAACCCATGTTGATCACAGG - Intergenic
1010305774 6:74320301-74320323 CTTATTTACATGTTGATGAATGG - Intergenic
1012465230 6:99510040-99510062 TTCAAACCCATGTTGTTGAAGGG + Intronic
1013205671 6:107943549-107943571 TTCAAACCCATGTTGTTGAAGGG + Intronic
1013439003 6:110142238-110142260 ATCACACACATTTTGATGAAAGG + Intronic
1014269792 6:119324080-119324102 TTCAAACCCATGTTGTTCAAGGG - Intronic
1014311828 6:119813282-119813304 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1014623138 6:123694091-123694113 CTCTAACACATTTTGACCAAGGG - Intergenic
1014645866 6:123971917-123971939 TTCAAACCCATGTTGTTCAAAGG - Intronic
1014960739 6:127681267-127681289 TTCAAACGCATGTTGTTCAAGGG - Intergenic
1015168128 6:130221784-130221806 TTCCAACACATGTTGTTCAAGGG + Intronic
1015646939 6:135402505-135402527 TTCAAACTCATGTTGTTCAAGGG - Intronic
1016427082 6:143946230-143946252 CTCAAACTCATGTTGTTCAAGGG + Intronic
1017984303 6:159429594-159429616 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1018014382 6:159698992-159699014 TTCAAACCCATGTTGTTCAAGGG + Intronic
1018131883 6:160739537-160739559 CTTAAACATATTATGATGAAGGG - Intronic
1019096830 6:169588540-169588562 TTCAAACCCATGTTGTTCAAGGG + Intronic
1019208962 6:170389140-170389162 TTCAAACCCATGTTGTTCAAGGG + Intronic
1020488525 7:8749435-8749457 CTCAACCACTTGTTACTGAAAGG - Intronic
1021164481 7:17319033-17319055 TTCAAACCCATGTTGTTCAAGGG + Intronic
1021407914 7:20295239-20295261 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1021809017 7:24384951-24384973 TTCAAACCCATGTTGTTTAAGGG - Intergenic
1021928115 7:25552823-25552845 CTCAAAGACATGTTCTTGAAGGG + Intergenic
1022018301 7:26374134-26374156 CTCAAATACATATTGCTGAAGGG - Exonic
1022858540 7:34341115-34341137 TTCAAAAACAAGTTGAAGAAAGG - Intergenic
1023134325 7:37036248-37036270 TTCAAACCCATGTTGCTCAAGGG + Intronic
1023425221 7:40028991-40029013 CTCAAACCCATGATGTTCAAGGG - Intronic
1027569022 7:79838946-79838968 CCAAAACACTTGTTGCTGAAAGG + Intergenic
1027893195 7:84004866-84004888 TTCAAACCCATGTTGTTCAAGGG - Intronic
1028152777 7:87393816-87393838 TTCAAACCCATGTTGTTCAAGGG - Intronic
1028996959 7:97111344-97111366 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1031200479 7:118677928-118677950 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1031849093 7:126841944-126841966 TTCAAACAAATGTTGTTGAGAGG + Intronic
1032305426 7:130729620-130729642 TTCAAACTCATGTTGCTCAAGGG + Intergenic
1032730254 7:134634681-134634703 CTCAAACCCATGTTGTTCTAGGG - Intergenic
1032863188 7:135901332-135901354 TTCAAACACATGCTGTTCAAGGG + Intergenic
1033050496 7:138000253-138000275 CTCAAATATCTTTTGATGAATGG - Intronic
1034021622 7:147650369-147650391 TTTAAACTCATGTTGTTGAAGGG - Intronic
1034238772 7:149593441-149593463 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1034242200 7:149619205-149619227 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1036164286 8:6418049-6418071 CTCAAACACATGTTGTTCAGGGG + Intronic
1036235758 8:7038076-7038098 TTCAGACACATGTATATGAAAGG - Intergenic
1037126052 8:15351207-15351229 CAATAACAAATGTTGATGAAGGG + Intergenic
1037189596 8:16107120-16107142 TTCAAACACATATTGTTTAAGGG - Intergenic
1038346007 8:26733217-26733239 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1039033677 8:33336014-33336036 TTCAAACGCATGTTGTTCAAAGG + Intergenic
1039068401 8:33629293-33629315 CTCTAATACCTGTTGATGAATGG - Intergenic
1039270691 8:35877081-35877103 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1040636566 8:49281277-49281299 CTCAAACTCGTGTTGTTTAAGGG + Intergenic
1040765126 8:50900372-50900394 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1041407750 8:57518908-57518930 TTCAAACTCATGTTGTTCAAGGG + Intergenic
1041863803 8:62545110-62545132 CTCAAACCCATGTTGTTTAAGGG + Intronic
1041992395 8:64009194-64009216 TTCAAACTAATGTTGATAAATGG + Intergenic
1042868829 8:73379233-73379255 TTCAAACCCATGTTGCTCAAGGG - Intergenic
1043077723 8:75722976-75722998 CTCAAACTCATGTTGTTCAAGGG - Intergenic
1043980078 8:86627816-86627838 TTCAAACACGTGTTGTTCAAGGG - Intronic
1044036674 8:87312426-87312448 CCCAAACACATGTTAATTCAAGG + Intronic
1044484193 8:92731040-92731062 CTCAAAAACAAGTTGCTGAATGG - Intergenic
1044912684 8:97077790-97077812 TTCAAACTCATGTTGTTCAAAGG + Intronic
1045605874 8:103774546-103774568 CTCAAAATCATTGTGATGAATGG + Intronic
1045605878 8:103774636-103774658 CTCAAAATCATTGTGATGAATGG + Intronic
1045668774 8:104523117-104523139 TTCAAACCCATGTTGTTCAAAGG - Intronic
1046146279 8:110164320-110164342 CTCAAACAGACGTTTATTAAGGG - Intergenic
1046414593 8:113896166-113896188 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1046921380 8:119732922-119732944 TTCAAACCCATGTTGTTCAAGGG - Intronic
1047108709 8:121764567-121764589 CTGGAACAGGTGTTGATGAACGG - Intergenic
1047113118 8:121812962-121812984 CTCAAACCAATGTTGTTCAAGGG - Intergenic
1048462374 8:134632063-134632085 TTCAAACCCATGTTGTTCAAGGG - Intronic
1049052368 8:140208783-140208805 CTCAGACCCATGTTGTTCAAGGG - Intronic
1049837043 8:144742946-144742968 TTCAAACCCATGTTGTTCAAAGG + Intronic
1051189033 9:14491842-14491864 ATCAAAATCATGATGATGAAGGG + Intergenic
1051604100 9:18903887-18903909 TTCAAACCCATGTTGTTCAAAGG + Intronic
1052272685 9:26642876-26642898 GCCAAAAACATGTTGTTGAAAGG - Intergenic
1052435415 9:28421739-28421761 ATCAAACCCATGTTGTTCAAGGG + Intronic
1052473395 9:28928430-28928452 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1052479536 9:29005808-29005830 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1052968087 9:34357077-34357099 TTCAAACCCATGTTGGTCAAGGG + Intergenic
1053226604 9:36363826-36363848 TTCAAACTCATGTTGTTCAAGGG - Intronic
1053445260 9:38147791-38147813 CTCAAACACATCATGCTGAGTGG - Intergenic
1054946390 9:70800471-70800493 TTCAAACCCATGTTGTTCAAGGG - Intronic
1055741887 9:79398080-79398102 CTTCAACACAGGTGGATGAATGG + Intergenic
1056938832 9:90937855-90937877 TTCAAACCCATGTTGTTAAAGGG + Intergenic
1057059432 9:91990318-91990340 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1057737040 9:97672621-97672643 TTCAAACCCATGTTGTTCAAGGG - Exonic
1060652912 9:125345542-125345564 TTCAAACCCATGTTGTTCAAGGG + Intronic
1061645376 9:131996665-131996687 TTCAAACTCATGTTGTTCAAGGG - Intronic
1203533289 Un_KI270743v1:6150-6172 CTCAAAGAGCTGTTGAGGAAGGG - Intergenic
1185994035 X:4924133-4924155 CTAGAACACATGTTCATGACTGG + Intergenic
1186259585 X:7762526-7762548 GTCAACCACATGGTGATGAATGG + Intergenic
1186501790 X:10056708-10056730 TTCAAACCCATGTTGTTTAAGGG - Intronic
1186730002 X:12399817-12399839 TTCAAACCCATGTTGTTCAAGGG + Intronic
1187441346 X:19323496-19323518 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1187493449 X:19774285-19774307 CTCAAACAGTTGTTTATAAAAGG - Intronic
1187984787 X:24798307-24798329 TTCAAACTCATGTTGCTTAAGGG - Intronic
1188377014 X:29443847-29443869 CTCATTCTTATGTTGATGAAAGG + Intronic
1189979777 X:46497534-46497556 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1190475868 X:50826936-50826958 TTCAAACACATGTTGTTTAAAGG - Intergenic
1190814838 X:53920791-53920813 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1190823875 X:53999126-53999148 TTCAAACCCATGTTGTTCAAGGG - Intronic
1192666294 X:73090412-73090434 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1193319817 X:80108063-80108085 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1193445470 X:81596442-81596464 CTAGAACACATGTATATGAAGGG + Intergenic
1193570468 X:83135540-83135562 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1193694044 X:84685021-84685043 TTCAAACCCCTGTTGTTGAAGGG - Intergenic
1194619749 X:96156244-96156266 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1194967230 X:100302453-100302475 TTCAAACCCATGTTGTTCAAGGG - Intronic
1195035774 X:100970743-100970765 TTCAAACCCATGTTGTTCAAGGG + Intronic
1195506436 X:105663068-105663090 TTCAAACACATGTTGTTTTAAGG - Intronic
1195577382 X:106467230-106467252 ATCAAACAGAGGTTGATAAAAGG + Intergenic
1195933577 X:110103880-110103902 CTCAAACCCATGTTGTTCAAGGG - Intronic
1196082787 X:111650388-111650410 TTCAAACCCATGTTGATCAAGGG + Intergenic
1196786155 X:119423216-119423238 CTCAAATCCATGTTGTTCAAAGG + Intronic
1196936698 X:120737477-120737499 CTAAATCATATGTAGATGAAAGG - Intergenic
1197046643 X:122005358-122005380 ATCAAACACAGGTTGGTAAAAGG - Intergenic
1197441511 X:126496317-126496339 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1197976535 X:132171801-132171823 CTAAAACCCATGTAGATGATGGG + Intergenic
1198303643 X:135356988-135357010 TTCAAACCCATGTTGTTCAATGG + Intronic
1198448394 X:136741241-136741263 TTCAAACCCATGTTGTTCAAGGG - Intronic
1199350221 X:146791344-146791366 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1199614285 X:149644119-149644141 TTCAAACCCATGTTGTTCAAAGG + Intergenic
1200914525 Y:8559795-8559817 CTCAACCTCATCTGGATGAAGGG + Intergenic
1201492161 Y:14554065-14554087 ATCAAACACAAGTTTTTGAAGGG - Intronic
1201645543 Y:16225909-16225931 TTCAAACCCATGTTGTTCAAGGG + Intergenic
1201657270 Y:16359405-16359427 TTCAAACCCATGTTGTTCAAGGG - Intergenic
1201890800 Y:18941844-18941866 TTCAAACTCATGTTGTTCAAAGG - Intergenic