ID: 1078525836

View in Genome Browser
Species Human (GRCh38)
Location 11:12100655-12100677
Sequence CTCACTGGGTGGAAAGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 231}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078525829_1078525836 6 Left 1078525829 11:12100626-12100648 CCCAAGGTGGTGACCTGTAGTAC 0: 1
1: 0
2: 1
3: 6
4: 61
Right 1078525836 11:12100655-12100677 CTCACTGGGTGGAAAGGAACAGG 0: 1
1: 0
2: 0
3: 19
4: 231
1078525831_1078525836 -7 Left 1078525831 11:12100639-12100661 CCTGTAGTACAGTCTTCTCACTG 0: 1
1: 0
2: 2
3: 10
4: 110
Right 1078525836 11:12100655-12100677 CTCACTGGGTGGAAAGGAACAGG 0: 1
1: 0
2: 0
3: 19
4: 231
1078525830_1078525836 5 Left 1078525830 11:12100627-12100649 CCAAGGTGGTGACCTGTAGTACA 0: 1
1: 0
2: 1
3: 3
4: 88
Right 1078525836 11:12100655-12100677 CTCACTGGGTGGAAAGGAACAGG 0: 1
1: 0
2: 0
3: 19
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078525836 Original CRISPR CTCACTGGGTGGAAAGGAAC AGG Intronic
900437418 1:2637898-2637920 GGCACTGAGTGGGAAGGAACTGG + Intronic
900657666 1:3767732-3767754 ATCACTGGCTGGAAAGGAGGAGG + Intronic
901632532 1:10654941-10654963 CTCAGTGGGTGGACAGGGGCTGG + Intronic
904846172 1:33419390-33419412 TTCACTGGGTGGAAATCAAGGGG + Intronic
905394235 1:37657060-37657082 CACACTGGGTGGGAGGAAACCGG + Intergenic
905825707 1:41024460-41024482 CCCACCAGGTGGAAAGGCACAGG - Intergenic
906436645 1:45802400-45802422 CTGGATGGGTGGTAAGGAACTGG + Intronic
910506907 1:87959735-87959757 TTCACTGGATCCAAAGGAACAGG + Intergenic
911445523 1:97987122-97987144 CCCACAGGGTGGAAAGGATGGGG - Intergenic
913067690 1:115271638-115271660 CTCACAGGGTGGAAAGGGCAAGG + Intergenic
913530946 1:119733960-119733982 CCCACTGTGTGGAAAGGTACAGG - Intronic
913594434 1:120359738-120359760 TTCACTGGGGGGAACTGAACTGG + Intergenic
914092828 1:144519246-144519268 TTCACTGGGGGGAACTGAACTGG - Intergenic
914305700 1:146414627-146414649 TTCACTGGGGGGAACTGAACTGG + Intergenic
914596355 1:149158179-149158201 TTCACTGGGGGGAACTGAACTGG - Intergenic
916098033 1:161368670-161368692 ATCACAGAGTGGAAAGGATCAGG + Exonic
917608530 1:176661744-176661766 ATCCCTGGGTGCAAAGGAGCTGG + Intronic
917703259 1:177602759-177602781 CTCCCTAGGTGCAGAGGAACTGG + Intergenic
922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG + Intronic
1063206668 10:3838536-3838558 CTAAATGGGTGTTAAGGAACTGG + Intergenic
1065429234 10:25636912-25636934 CTCACTCGTTTGAAAAGAACAGG + Intergenic
1065857602 10:29842874-29842896 CTCACCTGGTGGAAGGGACCAGG + Intergenic
1067450093 10:46376756-46376778 CTGCCTGGGAGGAAAGGAAAAGG - Intronic
1067578704 10:47425609-47425631 CTCACAGAGAGGAAAGGAAAGGG + Intergenic
1067587150 10:47483007-47483029 CTGCCTGGGAGGAAAGGAAAAGG + Intronic
1067634209 10:47990774-47990796 CTGCCTGGGAGGAAAGGAAAAGG + Intergenic
1067636315 10:48003002-48003024 CTCCCTGGGTCTAAAGGGACAGG + Intergenic
1069130315 10:64692788-64692810 CTCACTGCGTCTAAAGCAACTGG + Intergenic
1069543487 10:69312984-69313006 CTCTCTGAGTGGAGATGAACAGG + Intronic
1071126326 10:82339539-82339561 CTCCGTGTGTGGAAAGGACCTGG - Intronic
1072615004 10:97043365-97043387 CTCACAGTGTGGAGAGGGACTGG + Exonic
1076329278 10:129652940-129652962 CACACTGCTTGGGAAGGAACTGG - Intronic
1077267695 11:1660230-1660252 GTCTCTGAGGGGAAAGGAACAGG + Intergenic
1078525836 11:12100655-12100677 CTCACTGGGTGGAAAGGAACAGG + Intronic
1078644948 11:13132847-13132869 AGCACTGGGTGTAAAGGAAAAGG - Intergenic
1082115128 11:48320068-48320090 CTCACTGGTTTGAAATGGACAGG - Intergenic
1082258538 11:50059223-50059245 CTCACTGGTTTGAAATGGACAGG + Intergenic
1083276060 11:61597773-61597795 CTCACTGGCTGGAGGGGAACGGG - Intergenic
1084100266 11:66943317-66943339 CTCACAGGGTGGAAGGGACAAGG - Intronic
1090277712 11:125431547-125431569 CTCGGTGGTTGGGAAGGAACAGG - Exonic
1092056214 12:5510361-5510383 CTCACTGCGGGAAAGGGAACAGG + Intronic
1092746073 12:11673808-11673830 CTAACTCGGGGGAAAGGAAAAGG - Intronic
1092860382 12:12715283-12715305 CAGACTGGGGGAAAAGGAACAGG - Intronic
1095704720 12:45224075-45224097 CTCACTGTCTAGAAAGGAAACGG + Intronic
1097387535 12:58967013-58967035 CTCACTGGGTGCAAAGTAGTCGG + Intergenic
1098854194 12:75633606-75633628 CTCACATGGTGGAAAGTACCAGG - Intergenic
1098939231 12:76515831-76515853 CTCACAGGGAGGAATGGAAGGGG - Intronic
1101325990 12:103716384-103716406 GTCACAGGGTGGAAAGATACAGG + Intronic
1101429095 12:104612091-104612113 CGCACTGCGTGAAATGGAACTGG + Intronic
1102458693 12:113087075-113087097 CTCTCTGCGGGGGAAGGAACGGG - Intronic
1102536990 12:113589043-113589065 CTCACTGGGTTGAGAAGAAAAGG - Intergenic
1104381986 12:128315265-128315287 GTCAGTGTGTGGAGAGGAACGGG + Intronic
1104414712 12:128588715-128588737 CTCACTTGGTGGAAGGAAAGAGG - Intronic
1104996943 12:132664183-132664205 CACACTGGGTGAAAAGGAAAGGG - Intronic
1106061567 13:26297939-26297961 CTCACTTGGTGGAAAGAGGCGGG + Intronic
1108437507 13:50415108-50415130 CTGAATTGGAGGAAAGGAACTGG + Intronic
1109470625 13:62799437-62799459 GTCTCTGGGTGGAAAGGGGCGGG + Intergenic
1113271421 13:108678967-108678989 CTCACAGGGTGGAAAGGGCAAGG + Intronic
1113962784 13:114134335-114134357 CACACTGCATGGAGAGGAACAGG + Intergenic
1117131964 14:52695708-52695730 CTCACGCGGCGGGAAGGAACCGG - Intronic
1121495794 14:94390679-94390701 CTTCCTGGGTGGGCAGGAACTGG - Exonic
1122298933 14:100720908-100720930 CTCACTGGATGGGAAGGGTCGGG + Intergenic
1123578841 15:21698158-21698180 CTCACTGAGTGGACAGTGACTGG - Intergenic
1123615468 15:22140640-22140662 CTCACTGAGTGGACAGTGACTGG - Intergenic
1123999068 15:25739834-25739856 CTGACTAGGTGGAAAGAAAGAGG + Intronic
1124060768 15:26291924-26291946 GTCACTGGGGGGTAAGGAAAAGG + Intergenic
1124159340 15:27254627-27254649 CTCACATGGTGGAAAGGACAAGG + Intronic
1126872369 15:53003277-53003299 CTCACTGGGTCTACACGAACTGG - Intergenic
1128292401 15:66488027-66488049 AGCACTGGGTGGGAAGGACCTGG - Intronic
1128340845 15:66821591-66821613 CTCCCTGGGAGGAAAGGAATGGG + Intergenic
1128791947 15:70440256-70440278 CTTACTGGGAGGAAAGGAGATGG - Intergenic
1129300107 15:74620598-74620620 GTCTCTGGGTGGGAAGGACCAGG - Intronic
1129887331 15:79047812-79047834 CACACTGGGAGGAAGGGTACTGG + Intronic
1130084000 15:80762030-80762052 GTCTCTGGCTGAAAAGGAACAGG - Intergenic
1131113154 15:89777509-89777531 CTCAGAGGGTGGAAAGTAGCAGG + Intronic
1131249295 15:90820105-90820127 CTCACTGGGTGCAAGGGACCTGG - Intergenic
1132028685 15:98423008-98423030 CTGACTGGCTGGAATGTAACAGG - Intergenic
1202987711 15_KI270727v1_random:432403-432425 CTCACTGAGTGGACAGTGACTGG - Intergenic
1133199678 16:4195674-4195696 CTCAAGGGGTGAGAAGGAACGGG + Exonic
1133954641 16:10431117-10431139 TACACTGGGTGGACAGCAACTGG - Exonic
1135088310 16:19492069-19492091 TCCACTGGATGCAAAGGAACTGG - Intronic
1139084176 16:63563922-63563944 CTGACTTGGTGGAAAGGACATGG + Intergenic
1139494525 16:67306612-67306634 ATCACTGTGTGGAGAGGACCTGG - Intronic
1139636891 16:68263631-68263653 GTCACTGGGTGGCAGGGAGCAGG + Intergenic
1141113333 16:81288182-81288204 GTCACTGAGTGGAAAGGAGATGG - Intronic
1141576816 16:84969410-84969432 TTCCCTGGGTGGAGGGGAACAGG - Intergenic
1141609226 16:85171642-85171664 CTCGCAGGGTGTATAGGAACAGG - Exonic
1141840873 16:86573315-86573337 CTCACTGGGAGGCAAGGGGCGGG - Intergenic
1142621196 17:1166650-1166672 CACACTGGATGGGAAGGACCAGG - Intronic
1142628547 17:1208197-1208219 GTCCCTGGGTGGAAAGGAAATGG + Intronic
1143976587 17:10834963-10834985 ACCACCGGGTGGGAAGGAACAGG - Intronic
1146488939 17:33266022-33266044 GGCTCTGGGTGGGAAGGAACTGG - Intronic
1147601907 17:41751977-41751999 CTCACTGCATTGAAATGAACTGG + Intergenic
1148716045 17:49716786-49716808 TTCACTGTGTGGAAAGGGAGAGG - Intronic
1149319081 17:55466663-55466685 CTCTCGGCCTGGAAAGGAACAGG - Intergenic
1150066708 17:62116130-62116152 TACACTGGGTGGCAGGGAACAGG + Intergenic
1150950939 17:69801726-69801748 GTTCCTGGGTGGAAGGGAACAGG + Intergenic
1151239066 17:72743741-72743763 CTCACTGGGGGGAAAAGGAAAGG + Intronic
1151886746 17:76927089-76927111 TTCCCTGGGTAGAAAGGAGCAGG + Intronic
1152058374 17:78050290-78050312 AGCACTGGGAGGGAAGGAACGGG + Exonic
1152411034 17:80123239-80123261 CTCCCTGTGTGGGAAGGGACAGG + Intergenic
1152709401 17:81863212-81863234 GGCACTGGGGGGAAGGGAACAGG - Intergenic
1152849612 17:82625155-82625177 GTCACTGGGTGGGAGGGGACAGG + Intronic
1154336878 18:13472802-13472824 TTCACTGGGTAGAAAGGGACAGG + Intronic
1154380294 18:13843548-13843570 CTCACAGTGTGGAAAGGGAGAGG + Intergenic
1156231235 18:35155835-35155857 CTGACTGTTGGGAAAGGAACCGG - Intergenic
1156462443 18:37328717-37328739 TTATCTGGGTGGATAGGAACTGG - Intronic
1157545703 18:48545067-48545089 CTTAATGGATGAAAAGGAACTGG + Intronic
1158455732 18:57605653-57605675 CTTACTGGGTGGTACAGAACAGG + Intronic
1160028227 18:75236361-75236383 CTCACTGGGAGGGAAGGGGCTGG + Intronic
1163157569 19:15447874-15447896 CCCACTGGGTGGTATGGAGCTGG - Intronic
1163980843 19:20898535-20898557 CTGAGTGGCTGGCAAGGAACAGG - Intergenic
1164419548 19:28076853-28076875 GACACTGATTGGAAAGGAACTGG + Intergenic
1165527353 19:36367457-36367479 CTCACAGGAGGGAAAAGAACTGG + Intronic
1166581207 19:43901719-43901741 GTCCCTGGTTGGAATGGAACCGG - Intergenic
928304256 2:30153367-30153389 CTCACATGGTGGAAAGGAGCAGG + Intronic
929879447 2:45823319-45823341 CTTTCTGGATGAAAAGGAACTGG + Intronic
929958680 2:46479940-46479962 CTTGCTGGGTGGATAGGACCTGG + Intronic
930063006 2:47306359-47306381 CTCACTGGGTTGAGAGCCACTGG + Intergenic
931444377 2:62314523-62314545 CAGAATGGGAGGAAAGGAACAGG + Intergenic
933419860 2:82031246-82031268 CCCACTGGGTGGAGTGGAGCTGG + Intergenic
933564461 2:83932747-83932769 CACACATAGTGGAAAGGAACAGG + Intergenic
933568039 2:83975293-83975315 GTCACTGGGTGACAATGAACTGG + Intergenic
937378539 2:121354786-121354808 CTCAGTGGGTGGAAAGAACACGG + Intronic
937737854 2:125313406-125313428 GTCCCTGGGTGGCAAGGCACAGG - Intergenic
937797620 2:126042529-126042551 CTCACATGGTGGAAAGGACAAGG - Intergenic
938740967 2:134231867-134231889 CTCACTGGGTGTAAAGTACCAGG - Intronic
946520216 2:220456451-220456473 ATCACTGGGAGGAAAGAAAGCGG + Intergenic
947594024 2:231399718-231399740 CTCCCTGGCTGGAAAGCAGCCGG + Exonic
1169077405 20:2769654-2769676 CACACTGGCTGGTAAGGATCTGG + Intergenic
1169746908 20:8952065-8952087 CCCACTGGAGGGAAAGGAGCTGG - Intronic
1172385674 20:34532464-34532486 CTTGCTGGGTGGCAAGAAACTGG + Intronic
1172410568 20:34719043-34719065 CCAACTGGGTGGTAAAGAACTGG + Intronic
1173080135 20:39858871-39858893 CTCACTGGATGAAAGGGAACAGG + Intergenic
1173720278 20:45252348-45252370 GTCTCAGGGTGGAAAGGACCTGG + Exonic
1177235698 21:18386912-18386934 TTCACTGAGTTGAAAGTAACTGG + Intronic
1178347015 21:31838376-31838398 CTCTGTAGGTGAAAAGGAACTGG + Intergenic
1178986188 21:37305170-37305192 CTCACTGGCTGCTAGGGAACTGG - Intergenic
1180115512 21:45701252-45701274 CTCAGTGTGAGGAAAGGGACAGG + Intronic
1180171898 21:46063930-46063952 CTCTCTGGGTGGGGAGGATCTGG - Intergenic
1181962034 22:26629135-26629157 CCTCCTGGGTGGAAAGGAAAGGG - Intronic
1203294831 22_KI270736v1_random:32045-32067 CCCCCTGAGCGGAAAGGAACTGG + Intergenic
950095919 3:10330368-10330390 CTCACAGGGTGCAGAGGGACGGG + Intronic
950644967 3:14371645-14371667 CCCACTGGGTGAGAAGGAAACGG + Intergenic
950831506 3:15879683-15879705 CTCTCTCGCTGGAAAGGAGCTGG - Intergenic
951926257 3:27911937-27911959 GTCACTGGGTGGAAGGAAAGAGG - Intergenic
954719393 3:52548162-52548184 CTCACTGGCTGAAAAGCAAAGGG - Exonic
959476788 3:106821711-106821733 GTTCCTGGGTGGAAAGGAGCAGG + Intergenic
961009316 3:123425287-123425309 CTCACTTGGGGGAAAGGGATTGG + Intronic
961925842 3:130479193-130479215 CTCACATGGTGGAAGGGAAGAGG - Intronic
962814906 3:138988839-138988861 CTCACAGGGTGGAAGGGGCCAGG + Intergenic
964680266 3:159330789-159330811 ATCACTGTTTGAAAAGGAACTGG + Intronic
965071890 3:163925061-163925083 CTCACGGGGTGGAAAGGACTTGG - Intergenic
966666437 3:182477246-182477268 CCTACTGGGAGGAAAAGAACAGG - Intergenic
968220898 3:196939126-196939148 CACACTGGGTGGAAAGTAGGAGG + Intronic
969052095 4:4380242-4380264 CTCACTGGGGGTAACTGAACAGG + Intronic
971476498 4:27077510-27077532 CTTCCTGGGAGGAAAGAAACAGG + Intergenic
972914023 4:43853616-43853638 CTCACATGGTGGAAAGGACAAGG + Intergenic
977876916 4:102160942-102160964 TTCACTTGGTGGAAAGGAAAAGG - Intergenic
980967773 4:139539836-139539858 CTCACATGGTGGAAAGTAAAGGG - Intronic
980977895 4:139628628-139628650 CTCAATGGGTCGATAGCAACAGG + Intergenic
981402694 4:144332481-144332503 CTCACTTGGTGGAAAGGGCAAGG + Intergenic
982255766 4:153450350-153450372 GTCACTGGCTCGAAAGCAACAGG - Intergenic
982320835 4:154075851-154075873 CCTACTGGGTGGAAAAGAATGGG + Intergenic
982787141 4:159549122-159549144 CTCACTGGCTAGAAGGCAACAGG - Intergenic
986140530 5:5025889-5025911 TCCACTTGGTGGAAGGGAACCGG + Intergenic
986168708 5:5297982-5298004 ATGACTGGTTGGCAAGGAACAGG - Intronic
986748769 5:10766458-10766480 CTCACTTGGGGGAATGGAACTGG - Intergenic
986867980 5:12012574-12012596 CTCACATGGTGGAAGGGAAGAGG - Intergenic
990637128 5:57741390-57741412 CTAACTGGAAGGAAAGAAACTGG - Intergenic
991460179 5:66849656-66849678 CCCACAGGGTGGAAAGAGACAGG - Intronic
995024436 5:107402861-107402883 CTTTGTGGGAGGAAAGGAACTGG + Intronic
995088780 5:108147029-108147051 CTCACATGGTGGAAGGGGACAGG + Intronic
995635005 5:114178083-114178105 CTTCCTTGGTGGAAAGGAATAGG - Intergenic
995734313 5:115282713-115282735 TTATCTGAGTGGAAAGGAACTGG + Intronic
995768988 5:115649462-115649484 CTCACTGTCTGGTAAAGAACAGG + Intergenic
995843534 5:116468018-116468040 CCCACTGGGTGCACAGGAAGAGG - Intronic
995852968 5:116565754-116565776 CTCTCTGGGTAGAAAGGAGGAGG + Intronic
997463702 5:134072529-134072551 CACACTGGGGGGAAAGGACCAGG + Intergenic
997594669 5:135098859-135098881 CTTCCTGGGTGGGAAGGAGCAGG + Intronic
998182293 5:139954031-139954053 CTCACTGGGAGGCAAGGGGCAGG + Intronic
1000024485 5:157346947-157346969 CTTACAAGGTTGAAAGGAACAGG - Intronic
1001844104 5:174905081-174905103 CTCACTGCGTCGAGAGGAATGGG - Intergenic
1002205875 5:177562257-177562279 GTCACAGGGTGGAAAGGAGGAGG - Intergenic
1002799980 6:513149-513171 GTCACAGGCTGGAATGGAACTGG + Intronic
1003181831 6:3798699-3798721 CTCACGGGGTGGGAAGGAAGTGG - Intergenic
1005641338 6:27799450-27799472 TTCATTGCATGGAAAGGAACAGG + Intergenic
1006640061 6:35485286-35485308 CTCACAGGGTGGAGAGACACTGG - Intronic
1008410753 6:51175835-51175857 CAAACTGGGTTGAAAGAAACAGG + Intergenic
1009291572 6:61889341-61889363 GTCACTGGGTGGACAGGATGTGG - Intronic
1009905061 6:69860013-69860035 CTCACTTAGTGGAAAGGGAGAGG + Intergenic
1011622854 6:89259056-89259078 CTAAGTGGGAGGAAAGGAAATGG + Intronic
1011686756 6:89829888-89829910 CTCGGTGGGCAGAAAGGAACCGG + Exonic
1012402077 6:98848995-98849017 CACTCTGGGTAGAAGGGAACTGG + Intergenic
1012861389 6:104564101-104564123 CTCAAAGGGTGGAAAGTAAAGGG - Intergenic
1013072892 6:106744929-106744951 CTCACTCTGTGGCAAGTAACTGG - Intergenic
1015242734 6:131043940-131043962 CTGAATGGTGGGAAAGGAACGGG + Intronic
1015532349 6:134233361-134233383 GTCACTGGGTAAAGAGGAACAGG + Intronic
1016752989 6:147651560-147651582 CTCACACGGTGGAAAGGGCCAGG - Intronic
1020363035 7:7350184-7350206 GTCTCAGGGTGGAGAGGAACAGG + Intergenic
1020853642 7:13389665-13389687 CTCACTGGAGGGGAAGGAAGAGG - Intergenic
1021269866 7:18573500-18573522 CCGAGTGGGTGGAAAGAAACGGG - Intronic
1021436049 7:20616818-20616840 CTCACTGTATGGAAAGCTACAGG - Intronic
1021863656 7:24932591-24932613 CTCACAGGGTGGAAGGGACAAGG - Intronic
1022895900 7:34750215-34750237 TGCACAGGGAGGAAAGGAACAGG + Intronic
1027457574 7:78412638-78412660 CTCACTGGGTTGAGAGAAAAGGG + Intronic
1027727278 7:81823508-81823530 CTCACTTGGTGAAAAGTAGCAGG - Intergenic
1029425224 7:100490320-100490342 ACCAATGGGTGGAAAGGAAGGGG + Intronic
1029686115 7:102149370-102149392 CCCACTGGGTAGACAGGAAGGGG + Intronic
1030692357 7:112548266-112548288 CTCACTGGGTATGAAGGAAATGG - Intergenic
1032018210 7:128392876-128392898 CTCTCTGCCTGGAAAGGAGCTGG + Exonic
1032845524 7:135748646-135748668 CTCACTGGGAAGAACGGCACGGG - Exonic
1033118339 7:138645741-138645763 CTCTCTGGGTGGAACAGGACTGG + Intronic
1033477370 7:141703516-141703538 CTCACTGGGAAGAAATGAGCAGG - Intergenic
1034460494 7:151195518-151195540 CACACAGGGAGGCAAGGAACAGG - Intronic
1034512292 7:151545847-151545869 CTCACTGTGAGGAGATGAACAGG + Intergenic
1035328484 7:158081056-158081078 TTCACTGTGTGGAGAGGGACTGG - Intronic
1035369088 7:158367414-158367436 CTCACTGGTGGGAAAGGGAAAGG + Intronic
1036557564 8:9873672-9873694 CACCCTGGCTGGAAATGAACCGG + Intergenic
1036931335 8:12959156-12959178 CTTCCTGGGTGAAAGGGAACAGG + Intronic
1040610563 8:48977990-48978012 CTCCTTGGGTGGGAAGGCACTGG + Intergenic
1046866364 8:119155485-119155507 TTCAGTGGGTGGTATGGAACTGG - Intergenic
1047344740 8:124016117-124016139 CTCCCTGTGGGGAAAGGAAAGGG + Intronic
1047531194 8:125677788-125677810 GTCCTTGGGTGGAAAAGAACTGG + Intergenic
1048336936 8:133509617-133509639 ATCACAGGGTGGAAAGTAGCTGG + Intronic
1048848191 8:138619605-138619627 CTGACAGGGTGGATAGAAACTGG - Intronic
1049028314 8:140012993-140013015 CTCAGTGTGTGTAAAGGAACTGG - Intronic
1049224076 8:141441368-141441390 GCCAGTGGGTGGAAAGGAAGTGG - Intergenic
1049276944 8:141724721-141724743 ATCAGTGGGTGCAAAGGAGCAGG - Intergenic
1049417027 8:142499956-142499978 CCATCTGGGTGCAAAGGAACCGG - Intronic
1050039538 9:1474796-1474818 CTCACTGAGTAGAATGGCACTGG - Intergenic
1051483413 9:17583424-17583446 CTCACACGGTGGAAGGGGACAGG - Intronic
1051875265 9:21786490-21786512 CTCCATGGATGGAAAGGAAGTGG + Intergenic
1051900022 9:22027091-22027113 CTCACAGGGCGGAAAGAAAGGGG - Intronic
1052788469 9:32851882-32851904 CTCCCATGGTGGAAGGGAACCGG - Intergenic
1053152201 9:35750224-35750246 CTCACTGTGGGAAAAGGAAAAGG - Exonic
1055501966 9:76910121-76910143 CTCACATGGTGGGAAGGAAGAGG - Intergenic
1056112361 9:83408478-83408500 CTCACTGGGTGCCAAGAAATGGG - Intronic
1056484119 9:87037039-87037061 CACACTGAGTAGCAAGGAACTGG + Intergenic
1056788581 9:89610741-89610763 CTGAGTGGATGGAAGGGAACTGG - Intergenic
1060527128 9:124326947-124326969 CTCACTGGGGGGTACGGCACTGG + Intronic
1060551364 9:124486962-124486984 CTCACAGGGTGGCAAGGAGCTGG + Intronic
1061288686 9:129638820-129638842 TTCTCTGGGTGGAAAGGGAATGG - Intronic
1061452517 9:130676139-130676161 CTCACTGGGGTGGAAGGAAGAGG - Intronic
1186395587 X:9205703-9205725 CTCACAGGGTGGAAGGGCAAGGG + Intergenic
1186908808 X:14139600-14139622 TTCACTGGGTAGAAAGGAAGGGG - Intergenic
1188006109 X:25016671-25016693 TTTACTGGGTGGGAAGGGACAGG + Intergenic
1188727778 X:33607046-33607068 GTTCCTGGGTGGAAAGGGACCGG - Intergenic
1190431883 X:50385989-50386011 CTCAGTGGTTGGAAAGAAACAGG + Intronic
1195361470 X:104086558-104086580 CTCACGGAGTGGAATGGAAGGGG - Intergenic
1195700323 X:107700583-107700605 CTCACTGGATGGGCAGGATCAGG + Intergenic