ID: 1078527021

View in Genome Browser
Species Human (GRCh38)
Location 11:12109283-12109305
Sequence ACGTGTGAAGGGCACTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 71}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078527018_1078527021 -5 Left 1078527018 11:12109265-12109287 CCAGGCTTAGATGAGATCACGTG 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1078527021 11:12109283-12109305 ACGTGTGAAGGGCACTCCCCAGG 0: 1
1: 0
2: 1
3: 5
4: 71
1078527017_1078527021 4 Left 1078527017 11:12109256-12109278 CCTGTCAAGCCAGGCTTAGATGA 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1078527021 11:12109283-12109305 ACGTGTGAAGGGCACTCCCCAGG 0: 1
1: 0
2: 1
3: 5
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078527021 Original CRISPR ACGTGTGAAGGGCACTCCCC AGG Intronic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
909860920 1:80604793-80604815 AAGTGTGAAGGGGTCTTCCCTGG + Intergenic
913093356 1:115494792-115494814 GCCTGGGAAGGGCACCCCCCAGG + Intergenic
919243033 1:194939176-194939198 ACTTCTGAAGGGCACAGCCCCGG + Intergenic
1063312974 10:4972780-4972802 ACGTGTGAAGGACACTGTGCAGG - Intronic
1063315019 10:4995266-4995288 ACGTGTGAAGGACACTGTGCAGG + Intronic
1063325980 10:5102681-5102703 ACGTGTGAAGGACACTGTGCAGG - Intronic
1063335918 10:5213187-5213209 ACGTGTGAAGGACACTGTGCAGG - Intronic
1063433046 10:6007801-6007823 ACTTGTGAAGGTCACAGCCCAGG - Intergenic
1071979509 10:90989080-90989102 CTGTGTGAAGGGCTTTCCCCAGG - Intergenic
1072622211 10:97087544-97087566 ATGAGTGAAGAGCACTGCCCTGG + Intronic
1078527021 11:12109283-12109305 ACGTGTGAAGGGCACTCCCCAGG + Intronic
1084562414 11:69912239-69912261 AGATGTGAAGGTCGCTCCCCCGG - Intergenic
1089489910 11:118876356-118876378 AAGTGTGAGGAGCACTCCCCTGG + Intergenic
1092218222 12:6696905-6696927 ATGAATGAAGGGCACTACCCGGG - Intronic
1103714653 12:122937581-122937603 AAGTGTGAACGGCTCTGCCCAGG + Intronic
1107980135 13:45727379-45727401 ACTTGTGAAGGTCACAGCCCAGG - Intergenic
1119179392 14:72594864-72594886 ACTTGTGAAGGCCACTGCCTTGG + Intergenic
1122928167 14:104919376-104919398 TCGTGTGCAGGTCCCTCCCCCGG - Intergenic
1123981984 15:25612957-25612979 GTGGGTGAAGGCCACTCCCCGGG + Intergenic
1124440038 15:29678914-29678936 CCATGTGAAGGGCACTGCACAGG + Intergenic
1132075037 15:98812861-98812883 ACGTGTGAAGGCAGCTCCTCTGG - Intronic
1132301415 15:100778546-100778568 TGGTGTCAAGGGCACTGCCCAGG - Intergenic
1132886225 16:2183395-2183417 ACGTGGGGAGGGGACTCTCCTGG + Intronic
1133818629 16:9216822-9216844 ACTTTTGACTGGCACTCCCCTGG + Intergenic
1133892714 16:9896000-9896022 CCTTGTGAATGGCTCTCCCCAGG - Intronic
1135931608 16:26742846-26742868 CCGTGTGAAAGGCACTCCCCAGG + Intergenic
1137308908 16:47233736-47233758 ACTTGTGAAGGTCACAGCCCAGG + Intronic
1140192325 16:72828635-72828657 ACCTGTGCAGGGCCCTGCCCAGG + Intronic
1148684021 17:49490687-49490709 ACTGGTGAAGGTCACTTCCCTGG + Intergenic
1152007543 17:77691912-77691934 AGGTGTGCAGGGCTCTCCCCGGG + Intergenic
1164623043 19:29708776-29708798 TTGTGTGCAGGGCATTCCCCGGG - Intronic
932448687 2:71795998-71796020 ACCTGAGAAGGGGACTCCACAGG + Intergenic
947472689 2:230413100-230413122 ACGAGTGAAGGGCAGGCGCCTGG - Intergenic
949001800 2:241619035-241619057 ACGTGTGAAGGTCACGGCTCAGG + Intronic
1173952093 20:47001470-47001492 ACAAGTGAATGGCACTCACCTGG - Exonic
1174212587 20:48891742-48891764 AAGTGTGCTGGGCTCTCCCCAGG + Intergenic
1175046737 20:56113394-56113416 ACTTGTGAAGGTCACAGCCCAGG + Intergenic
1175254811 20:57634823-57634845 ACTTGTGAAGGTCACAGCCCAGG + Intergenic
1180164120 21:46011592-46011614 CCGTGAGGAGGTCACTCCCCCGG - Intergenic
1181285430 22:21748530-21748552 ACCTGTGAAGGTCACAGCCCAGG + Intergenic
1185359061 22:50394267-50394289 AAGTGAGGAGGGCACTCCCATGG + Intronic
950306808 3:11921598-11921620 ACGTGTGAAGGTCACAGCCTAGG - Intergenic
955147001 3:56329647-56329669 ACTTGTGAAGGTCACAGCCCAGG + Intronic
959021344 3:101190807-101190829 ACATGTGATGGGCTCTCCCAGGG - Intergenic
961170934 3:124797286-124797308 CCGGGTGAAGGGCACCCACCTGG + Intronic
961335182 3:126171807-126171829 ACTTGTGAAGGTCACAGCCCAGG + Intronic
961456466 3:127027102-127027124 ACGTGTGCTGGGCGCTCCCCAGG + Intronic
965354896 3:167661834-167661856 ACATGTGTAGGGCACTACCCTGG + Intergenic
968585152 4:1412897-1412919 CCCTGTGCAGGGGACTCCCCAGG - Intergenic
970345475 4:15148594-15148616 AGGGGGGAAGGGCACTCCCTGGG + Intergenic
978928135 4:114275549-114275571 AGTTGTGAAGGTCACACCCCAGG - Intergenic
982617157 4:157653212-157653234 TCATGTGAAGGGCACCCTCCTGG - Intergenic
987194033 5:15507072-15507094 ACGTTTGAAGAGCACGCCCTGGG - Intronic
1009653953 6:66515162-66515184 ACTTATGAAGGACACTGCCCAGG + Intergenic
1013572377 6:111441953-111441975 ACTTGTGACGGTCACACCCCCGG - Intronic
1014226942 6:118859920-118859942 ACGTGTGAAGTTCACAGCCCAGG + Intronic
1015376777 6:132518748-132518770 ACGTGTGGTGGCCCCTCCCCCGG - Intergenic
1019712973 7:2525767-2525789 ACCTGTGCAGGGCACTCACCTGG - Exonic
1023059909 7:36316897-36316919 ACGTGTGAGGACCACTGCCCCGG - Intergenic
1023979652 7:45061255-45061277 ACATGTGAAGGCCACGGCCCAGG - Intronic
1024277040 7:47686260-47686282 ATCTGTGTAGGGCACTTCCCAGG + Intergenic
1033201982 7:139381248-139381270 ACATGTGAAAGTCACTGCCCTGG - Intronic
1034376093 7:150645826-150645848 ACCTGTGAAGGCCACAGCCCAGG - Intergenic
1035348708 7:158227499-158227521 ACGTGTGACGGGAAGACCCCAGG + Intronic
1047529253 8:125660330-125660352 ACCTGTGAATAGCACTCCGCTGG + Intergenic
1049932350 9:469669-469691 ATGTGTGCAGTGCATTCCCCTGG + Intergenic
1049945776 9:593982-594004 CAGTGTGAAGGGCACAGCCCAGG - Intronic
1057491801 9:95525942-95525964 ACGAGACAAGGGCATTCCCCCGG + Intergenic
1060859577 9:126943679-126943701 AGGAGTAAAGGGCACACCCCAGG - Intronic
1061946719 9:133912641-133912663 ACGTGTGCACAGCACTCCCGAGG + Intronic
1062265145 9:135683526-135683548 AGGTGTGAGGGGCACCCCCTAGG - Intergenic
1186579713 X:10804699-10804721 ACTTGTGAAGGTCACAGCCCAGG - Intronic
1189917662 X:45872667-45872689 AGGTGTGAAGGGGACTGCACAGG + Intergenic
1190816290 X:53932789-53932811 AAGTTTGAAGAGCACTCACCAGG - Intergenic
1192234248 X:69285910-69285932 ACGTGGGGAGGGGAGTCCCCTGG - Intergenic
1196682010 X:118479019-118479041 CTATGTGAATGGCACTCCCCTGG - Intergenic
1201232848 Y:11881708-11881730 AAGGGAGAAGGGCACTCCCTTGG + Intergenic