ID: 1078527228

View in Genome Browser
Species Human (GRCh38)
Location 11:12110453-12110475
Sequence GCCGCTGCCGCCGGCGCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 310}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078527228_1078527233 -2 Left 1078527228 11:12110453-12110475 CCACGTGCGCCGGCGGCAGCGGC 0: 1
1: 0
2: 4
3: 48
4: 310
Right 1078527233 11:12110474-12110496 GCGGTGACAGCCGGCCCCACGGG 0: 1
1: 0
2: 2
3: 4
4: 115
1078527228_1078527241 9 Left 1078527228 11:12110453-12110475 CCACGTGCGCCGGCGGCAGCGGC 0: 1
1: 0
2: 4
3: 48
4: 310
Right 1078527241 11:12110485-12110507 CGGCCCCACGGGGGCGGGGCGGG 0: 1
1: 1
2: 8
3: 61
4: 523
1078527228_1078527234 -1 Left 1078527228 11:12110453-12110475 CCACGTGCGCCGGCGGCAGCGGC 0: 1
1: 0
2: 4
3: 48
4: 310
Right 1078527234 11:12110475-12110497 CGGTGACAGCCGGCCCCACGGGG 0: 1
1: 0
2: 1
3: 6
4: 72
1078527228_1078527236 3 Left 1078527228 11:12110453-12110475 CCACGTGCGCCGGCGGCAGCGGC 0: 1
1: 0
2: 4
3: 48
4: 310
Right 1078527236 11:12110479-12110501 GACAGCCGGCCCCACGGGGGCGG 0: 1
1: 1
2: 1
3: 11
4: 128
1078527228_1078527237 4 Left 1078527228 11:12110453-12110475 CCACGTGCGCCGGCGGCAGCGGC 0: 1
1: 0
2: 4
3: 48
4: 310
Right 1078527237 11:12110480-12110502 ACAGCCGGCCCCACGGGGGCGGG 0: 1
1: 0
2: 2
3: 16
4: 168
1078527228_1078527238 5 Left 1078527228 11:12110453-12110475 CCACGTGCGCCGGCGGCAGCGGC 0: 1
1: 0
2: 4
3: 48
4: 310
Right 1078527238 11:12110481-12110503 CAGCCGGCCCCACGGGGGCGGGG 0: 1
1: 0
2: 4
3: 17
4: 205
1078527228_1078527232 -3 Left 1078527228 11:12110453-12110475 CCACGTGCGCCGGCGGCAGCGGC 0: 1
1: 0
2: 4
3: 48
4: 310
Right 1078527232 11:12110473-12110495 GGCGGTGACAGCCGGCCCCACGG 0: 1
1: 0
2: 0
3: 7
4: 147
1078527228_1078527235 0 Left 1078527228 11:12110453-12110475 CCACGTGCGCCGGCGGCAGCGGC 0: 1
1: 0
2: 4
3: 48
4: 310
Right 1078527235 11:12110476-12110498 GGTGACAGCCGGCCCCACGGGGG 0: 1
1: 0
2: 0
3: 6
4: 129
1078527228_1078527240 8 Left 1078527228 11:12110453-12110475 CCACGTGCGCCGGCGGCAGCGGC 0: 1
1: 0
2: 4
3: 48
4: 310
Right 1078527240 11:12110484-12110506 CCGGCCCCACGGGGGCGGGGCGG 0: 1
1: 0
2: 2
3: 36
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078527228 Original CRISPR GCCGCTGCCGCCGGCGCACG TGG (reversed) Intronic