ID: 1078529380

View in Genome Browser
Species Human (GRCh38)
Location 11:12125136-12125158
Sequence CTGTATCAGCAGCAGCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 190}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078529374_1078529380 10 Left 1078529374 11:12125103-12125125 CCCGCCAGAGCTCATCTCTGGCT 0: 1
1: 0
2: 1
3: 24
4: 255
Right 1078529380 11:12125136-12125158 CTGTATCAGCAGCAGCCCAGTGG 0: 1
1: 0
2: 1
3: 22
4: 190
1078529372_1078529380 13 Left 1078529372 11:12125100-12125122 CCACCCGCCAGAGCTCATCTCTG 0: 1
1: 0
2: 3
3: 21
4: 257
Right 1078529380 11:12125136-12125158 CTGTATCAGCAGCAGCCCAGTGG 0: 1
1: 0
2: 1
3: 22
4: 190
1078529376_1078529380 6 Left 1078529376 11:12125107-12125129 CCAGAGCTCATCTCTGGCTAGCC 0: 1
1: 0
2: 0
3: 17
4: 137
Right 1078529380 11:12125136-12125158 CTGTATCAGCAGCAGCCCAGTGG 0: 1
1: 0
2: 1
3: 22
4: 190
1078529371_1078529380 14 Left 1078529371 11:12125099-12125121 CCCACCCGCCAGAGCTCATCTCT 0: 1
1: 0
2: 1
3: 12
4: 165
Right 1078529380 11:12125136-12125158 CTGTATCAGCAGCAGCCCAGTGG 0: 1
1: 0
2: 1
3: 22
4: 190
1078529370_1078529380 15 Left 1078529370 11:12125098-12125120 CCCCACCCGCCAGAGCTCATCTC 0: 1
1: 0
2: 1
3: 21
4: 217
Right 1078529380 11:12125136-12125158 CTGTATCAGCAGCAGCCCAGTGG 0: 1
1: 0
2: 1
3: 22
4: 190
1078529375_1078529380 9 Left 1078529375 11:12125104-12125126 CCGCCAGAGCTCATCTCTGGCTA 0: 1
1: 0
2: 4
3: 20
4: 184
Right 1078529380 11:12125136-12125158 CTGTATCAGCAGCAGCCCAGTGG 0: 1
1: 0
2: 1
3: 22
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078529380 Original CRISPR CTGTATCAGCAGCAGCCCAG TGG Intronic
900161361 1:1225516-1225538 CAGCAGCCGCAGCAGCCCAGAGG + Intronic
900437409 1:2637800-2637822 TTGTAGCAGCAGCAGCCCCGAGG - Intronic
900519368 1:3098265-3098287 CTGCACCAGCCTCAGCCCAGTGG + Intronic
900838669 1:5028590-5028612 ATTTGTAAGCAGCAGCCCAGAGG - Intergenic
901953570 1:12768670-12768692 CTGGCTCAGCAGGAGCCCTGTGG - Intergenic
903759026 1:25684882-25684904 CTGGGCCAGCAGCAGCACAGGGG + Intronic
904863918 1:33561634-33561656 CTATCTCAGCACCAGCCCACTGG - Intronic
904998946 1:34653004-34653026 CCATACCAGCAGCTGCCCAGTGG + Intergenic
905343821 1:37297972-37297994 CAGTAACTGCAGGAGCCCAGGGG + Intergenic
906264296 1:44417121-44417143 CTGTCCCAGCTGCAACCCAGAGG - Intronic
907526659 1:55057704-55057726 CTGTATTAGAGGGAGCCCAGAGG + Intronic
910567369 1:88659589-88659611 CAGCATCAGCAGCAACTCAGAGG + Intergenic
910642820 1:89481789-89481811 CTTTATCAGCAGCAGGACAATGG - Intergenic
912013846 1:105006066-105006088 GTGTAGCTGCAGCTGCCCAGCGG - Intergenic
912823404 1:112885142-112885164 CTGTTTCAGTAGGAGCCCAGAGG + Intergenic
913053192 1:115134680-115134702 CTGGATCTGCAGCAGCCCTCAGG - Intergenic
915143901 1:153783484-153783506 CGGAAGCAGCCGCAGCCCAGCGG - Intergenic
916314955 1:163438730-163438752 CTGAAACAGCAGCAGCTCAGTGG - Intergenic
920050695 1:203162959-203162981 CTGTCTCAGCAGCCACACAGCGG - Intronic
920493888 1:206440438-206440460 GTGTACAAGCAGCAGCCCAGAGG + Intronic
920914151 1:210245791-210245813 GTGTATCAGGAGCAGAGCAGAGG + Exonic
921350501 1:214229878-214229900 CTCAATCAGCAGCAACCTAGTGG + Intergenic
923088359 1:230719273-230719295 CTGAATCAACAGCAGTCCATAGG - Intergenic
923624217 1:235601024-235601046 CTGAAACAGCAGCAGCCATGGGG - Intronic
924880193 1:248152548-248152570 CTGTCTCTGCTGCAGCACAGAGG + Intergenic
1064035831 10:11912734-11912756 TTGTTGCAGCAGAAGCCCAGAGG - Intergenic
1069594743 10:69663284-69663306 CTGTGTCAGCAGGAGCCCACAGG - Intergenic
1071394515 10:85208136-85208158 CTGTATCATCAGCATCCCTAAGG + Intergenic
1072801650 10:98396370-98396392 TTGTGTCTGCAGCAGCTCAGTGG - Intronic
1073909817 10:108328740-108328762 TTGTATCAGCAGCTTCCCAAGGG + Intergenic
1074134524 10:110615239-110615261 CTGTGCCAGCAGCAGCTCTGAGG + Intergenic
1075873601 10:125788863-125788885 CTGACTCAGCAGCAGCCATGGGG + Exonic
1077145755 11:1043506-1043528 CTGTCTCAGCAGCTCCCCGGGGG + Intergenic
1078361901 11:10675560-10675582 TGGCATCAGCAGCAGACCAGAGG - Intronic
1078529380 11:12125136-12125158 CTGTATCAGCAGCAGCCCAGTGG + Intronic
1078587084 11:12601162-12601184 CAGTATCAGCATCAGGCAAGGGG - Intergenic
1078881571 11:15454481-15454503 CTTTAACAGCAGCCACCCAGTGG + Intergenic
1081986198 11:47306160-47306182 CTGCTTCAGCTGCAGCCCAAGGG + Intronic
1083696127 11:64443887-64443909 CTGTAGGAGCAGAAGTCCAGTGG + Intergenic
1083860698 11:65418484-65418506 CTGTAGGTGCAGCAGCCCTGGGG + Intergenic
1084780897 11:71407610-71407632 CTGGATGAGCAGCACCCCACAGG + Intergenic
1084929266 11:72541390-72541412 TTGTATTAGCAAAAGCCCAGAGG - Intergenic
1085879524 11:80449382-80449404 CTGTTTCTGCAGCAGCATAGTGG - Intergenic
1086107435 11:83160542-83160564 CTGTATCAGCATCACCACACTGG + Intronic
1088943419 11:114484104-114484126 CAGCATCAGTAGGAGCCCAGTGG - Intergenic
1091006029 11:131954489-131954511 CTGTATCATCGGGAGCCCTGAGG - Intronic
1091854010 12:3724313-3724335 CTGGCTCAGCAGGAGCCTAGAGG - Intronic
1095725191 12:45444812-45444834 CTGCTGCAGCAGCAGGCCAGAGG - Intergenic
1097688050 12:62709467-62709489 CTGTGCCAGCAGAAGCCCAGAGG - Intronic
1100501980 12:95183166-95183188 CTTTATCAGCAGAAGCATAGTGG - Intronic
1101007436 12:100414903-100414925 CTGCAGCAGCAGCAGCTCTGGGG - Intronic
1101097494 12:101357851-101357873 CAGTATCAGCAGCATCTGAGGGG + Intronic
1101543648 12:105688987-105689009 TGGTATCAGCAGAGGCCCAGTGG - Intergenic
1101552296 12:105774001-105774023 TTGTACCAGCAGCTGCCCAGTGG - Intergenic
1101567885 12:105926448-105926470 AGGTATCAGCACCAGCCAAGTGG - Intergenic
1103939345 12:124493334-124493356 CTGTACCTGCAGCTGCCCAGAGG - Intronic
1105462733 13:20607242-20607264 CTGCGGCAGCAGCAGGCCAGGGG - Intronic
1105923614 13:24986966-24986988 CTGCAGCAGCAGCATCCCCGAGG - Intergenic
1106845750 13:33736233-33736255 AAGTATCAGCAGCCACCCAGAGG - Intergenic
1107538848 13:41365749-41365771 CTTTATCAGTAACAGCCCATAGG - Intronic
1110705137 13:78596264-78596286 CTGGAGAAGCAGCAGCCCACAGG - Intergenic
1115028254 14:28766876-28766898 CAGCAGCAGCAGCAGCCCAAAGG - Intergenic
1119689553 14:76660820-76660842 CTTTGTCAGCAGCTTCCCAGAGG + Intergenic
1120107973 14:80517905-80517927 CTGGATCAGGAGGAGCACAGTGG + Intronic
1121095508 14:91215601-91215623 CTGGATGAGCAGCAGGCCTGAGG + Intronic
1121433447 14:93903347-93903369 CTGCAGCAGCATCAGCCCCGGGG - Intergenic
1202864127 14_GL000225v1_random:104455-104477 CTCAACCAGCAGCAGGCCAGAGG + Intergenic
1123804157 15:23854313-23854335 CAGCATCCCCAGCAGCCCAGAGG + Intergenic
1126424103 15:48507126-48507148 CTGGGTCAGCAGGAGCCTAGAGG + Intronic
1126686133 15:51250519-51250541 CTCTATCAGATGCAGCCCACTGG - Intronic
1130103552 15:80912245-80912267 CTGTATCTGGAGCAGCCACGTGG + Intronic
1130223873 15:82043939-82043961 CGGGACCAGCAGCAGCGCAGCGG - Exonic
1131457118 15:92590235-92590257 CTGGATGAGCAGGAGTCCAGGGG - Intergenic
1131478438 15:92761692-92761714 CAGTAGCAGCAGAAGCCTAGTGG + Intronic
1132061688 15:98697554-98697576 CTGTATCTGCAGCAGAGCTGTGG + Intronic
1133612625 16:7447875-7447897 CTGTATCAGCATCAACCCCCTGG + Intronic
1133692371 16:8229206-8229228 CTTTGTCAGTAGCAGCACAGGGG + Intergenic
1134685421 16:16154966-16154988 CTGGAGCCGCAGCAGCCCACTGG + Exonic
1135112203 16:19699057-19699079 CTTTATTACCGGCAGCCCAGGGG + Intronic
1136368352 16:29820338-29820360 CTGCAGCAGAAGCAGCCCGGAGG + Exonic
1136519441 16:30786666-30786688 CTGTATCAGCAGCGGGACGGGGG - Intronic
1137867263 16:51913213-51913235 ATTCATAAGCAGCAGCCCAGAGG - Intergenic
1141036464 16:80630621-80630643 CTGTAACAGAAGCATCCCTGGGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141475223 16:84268385-84268407 CTGTGTCAGCACCATCCCTGGGG + Intergenic
1142720095 17:1770190-1770212 CTGTGTAAGCAGGAGCTCAGGGG + Intronic
1143353502 17:6307181-6307203 GTGCACCAGCAGCATCCCAGGGG + Intergenic
1143798339 17:9356762-9356784 CTGCTTCTGCTGCAGCCCAGGGG + Intronic
1144282171 17:13737034-13737056 GTGAATCAGCAGAAGCCTAGGGG + Intergenic
1144650616 17:17004693-17004715 CATCAGCAGCAGCAGCCCAGGGG - Intergenic
1145241184 17:21241814-21241836 CTCCAGCAACAGCAGCCCAGGGG - Exonic
1145276963 17:21437317-21437339 CTGGCTCAGCAGGACCCCAGGGG + Intergenic
1145713235 17:26995147-26995169 CTGGCTCAGCAGGACCCCAGGGG + Intergenic
1146480764 17:33203192-33203214 CTGTCTCAGAAGCAGCCCGAAGG + Intronic
1146506968 17:33414072-33414094 TTGTTCCCGCAGCAGCCCAGTGG + Intronic
1146925979 17:36745781-36745803 CCGTTTAAGCAGAAGCCCAGAGG + Intergenic
1147426759 17:40349486-40349508 CTGACTCACCAGCAGCCCTGAGG + Intronic
1147660127 17:42112930-42112952 CTGGATCAGGAGCAGCCTGGAGG + Intergenic
1147772472 17:42877560-42877582 AAGTGTCAGCAGCAGCCCAGGGG + Intergenic
1147957951 17:44147973-44147995 GTGTAACAGCAGCAGCCTGGAGG - Exonic
1148915020 17:50969241-50969263 CTGTATATTCAGAAGCCCAGTGG + Intronic
1148930028 17:51120613-51120635 GTGTATCAGGAGGAGCCCGGCGG - Exonic
1152246083 17:79185239-79185261 CTGTGCCAGCACCACCCCAGAGG - Intronic
1156553355 18:38041590-38041612 CAGTATCAGCCCCAGCCCAAAGG + Intergenic
1157364863 18:47055243-47055265 CTGTAATAGCAACAGCCCACAGG - Intronic
1159384921 18:67710730-67710752 CTCTATCAGCAGGAGTCCAGGGG - Intergenic
1159497378 18:69223560-69223582 CCATATCTGCAGCAGCTCAGAGG + Intergenic
1161267514 19:3371286-3371308 CTGAATCTGCAGCAGCCCTGAGG - Intronic
1165365319 19:35361760-35361782 CTGTATAAGCAAAAGCCCAGGGG + Intergenic
1165391923 19:35543769-35543791 CTGTAAAAGCAGCAGCCAAGGGG + Exonic
1165404716 19:35622595-35622617 CTGGATCTGCAGCAGCTCTGAGG - Exonic
1165695079 19:37894820-37894842 CTGTATCCGCAGCCGACCAGAGG - Exonic
1165746054 19:38229869-38229891 CTGTATCCCCAGCAGCCAATGGG - Intergenic
1165861628 19:38912117-38912139 CCGCAGCAGCAGCAGCTCAGAGG + Exonic
925177527 2:1795825-1795847 CTGCATCAGCAGCAGCCTGATGG + Intronic
925694677 2:6563418-6563440 CAGTATCAGCAGCAGTGCTGGGG - Intergenic
927895443 2:26778634-26778656 CTGTGGCAGCAGCTGCCCTGGGG - Exonic
932432204 2:71682796-71682818 CTGTATCCTCATCAGACCAGGGG - Intronic
933764487 2:85697483-85697505 CTGCAGCAGCAGCACCACAGTGG - Intronic
933969221 2:87456726-87456748 GTCTCTCAGCAGTAGCCCAGAGG - Intergenic
936324566 2:111493768-111493790 GTCTCTCAGCAGAAGCCCAGAGG + Intergenic
936982948 2:118280508-118280530 CTGTCTCCTCAGCATCCCAGTGG + Intergenic
937024073 2:118682873-118682895 CAGCAGCAGCAGCAGCACAGAGG - Intergenic
940460783 2:153959994-153960016 CTCTCTGACCAGCAGCCCAGTGG - Intronic
941270027 2:163413996-163414018 CTGAAGCAGCAGCTCCCCAGGGG + Intergenic
942323923 2:174759500-174759522 CTGTATCAGCTGCAGGCCCACGG + Exonic
947016490 2:225626300-225626322 GTGTAGCAGAAGCAGCACAGTGG + Intronic
947615148 2:231551335-231551357 CTCCATCAGCATCAGCCCATCGG - Intergenic
948844742 2:240677634-240677656 CAGTATCAGCATGAGCCCTGGGG - Intronic
948849118 2:240697245-240697267 CAGTATCAGCATGAGCCCTGGGG + Intronic
948990319 2:241550777-241550799 CGGCATGAGCAGCAGACCAGGGG + Intergenic
1169539039 20:6580284-6580306 CCTTATTAGCAGCAGCCCAATGG + Intergenic
1171299276 20:24045545-24045567 CTGCATCTGCAGGAGCTCAGAGG + Intergenic
1172096707 20:32463999-32464021 CTGTCACAGCAGCAGCCAGGCGG + Intronic
1172379938 20:34481524-34481546 CTTTATCAGCAGCAGGAAAGTGG - Intronic
1174751540 20:53115969-53115991 CTGTAACCACAGCAGCCCATTGG - Intronic
1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG + Intergenic
1175799799 20:61794998-61795020 CTTTATCACCATCATCCCAGTGG - Intronic
1175842723 20:62040426-62040448 CAGTGACAGCAGCAGCTCAGTGG + Intronic
1176008986 20:62881693-62881715 CTGAAGCAGCTGCAGCCGAGCGG - Exonic
1177732307 21:25043435-25043457 CACTAACAGCAGAAGCCCAGGGG + Intergenic
1179959839 21:44762028-44762050 CTCAAACAGAAGCAGCCCAGTGG + Intergenic
1183075219 22:35422572-35422594 CTGTGCCTGCAGCATCCCAGAGG - Intronic
1184074036 22:42164853-42164875 CTGTGTGTGCAGAAGCCCAGAGG + Intronic
1184915299 22:47564767-47564789 ATCCATCAGCAGCACCCCAGGGG - Intergenic
1185077537 22:48691320-48691342 CTGCATCAGCAGCAGTCCCAGGG - Intronic
952788152 3:37176256-37176278 CTGTCTCAGCCGCGGCGCAGAGG - Intronic
953794750 3:45976040-45976062 TTGAATCAGAAGGAGCCCAGGGG + Intronic
955728830 3:61961762-61961784 CAGCATCAGCATCAACCCAGGGG + Intronic
958981544 3:100726148-100726170 TTGTACCAGCAGCTTCCCAGGGG - Intronic
959575652 3:107930174-107930196 ATGTATAAGCAGAAGCTCAGGGG + Intergenic
959578117 3:107957023-107957045 TTGTACCAGCCGGAGCCCAGAGG + Intergenic
960041205 3:113151591-113151613 CTGGCTCAGCAGGGGCCCAGTGG - Intergenic
963121219 3:141778459-141778481 CTGTGTGAGCAGCAGCCCATCGG + Exonic
963969277 3:151411431-151411453 CAGATTCAGCAGCAGCCGAGTGG + Exonic
968555224 4:1243509-1243531 CTGTCTCAGAAACAGCCCTGGGG + Intronic
969689369 4:8695856-8695878 CTTAATCAGCTGCAGCCCTGGGG + Intergenic
971154638 4:24068332-24068354 CAGTATCTGCAGAAGCCCAGAGG + Intergenic
973566145 4:52189598-52189620 CTGAAGCAGCAGCAGCCCCTGGG - Intergenic
977137678 4:93326297-93326319 AGGTATCTGTAGCAGCCCAGTGG - Intronic
977417326 4:96749579-96749601 CTGTCCCAGCACAAGCCCAGAGG - Intergenic
981506537 4:145506551-145506573 CTGTATCAGCTTCAGACTAGAGG - Intronic
983890670 4:173026408-173026430 CTGTAAGAGCAGCAGGCCAGAGG - Intronic
984667628 4:182446149-182446171 CAGTAGCAGTAGCAGCCCATGGG - Intronic
985067963 4:186142083-186142105 CGGTAGAAGCAACAGCCCAGAGG + Intronic
986266024 5:6191057-6191079 CTGTAGCAGCTGCTGCCCATTGG - Intergenic
988799722 5:34684887-34684909 CTTTAACAGCACCATCCCAGAGG - Intronic
989285249 5:39691863-39691885 CTGTAGCATCAGAAGCCTAGTGG - Intergenic
990305638 5:54492048-54492070 CCTTCCCAGCAGCAGCCCAGGGG - Intergenic
997341642 5:133149803-133149825 CTGTCTGGGCAGCAGCCCTGCGG + Intergenic
997916572 5:137932662-137932684 CTTTATCAGCAGCAGCAGTGAGG - Intronic
998744288 5:145239425-145239447 CTGGGTCAGCAGAGGCCCAGAGG + Intergenic
1003400504 6:5786746-5786768 CTGCAGCAGCAGCATCCCTGAGG - Intergenic
1006034974 6:31204235-31204257 CTGTAAAAGCAGCAGCCAAATGG - Intergenic
1008649511 6:53548334-53548356 TAGCAGCAGCAGCAGCCCAGAGG - Intronic
1010879481 6:81150360-81150382 ATTTCTCAGCACCAGCCCAGAGG + Intergenic
1012668917 6:102015650-102015672 CAGTAGCAGCAGCAGCACGGTGG - Intronic
1016186740 6:141206741-141206763 CTGTTTTATCAGCAGTCCAGAGG + Intergenic
1017741097 6:157407328-157407350 GTGTATAGGCAGCAGCGCAGAGG + Intronic
1018981268 6:168603426-168603448 CTGTCCCAGCAGCTTCCCAGGGG - Intronic
1019331555 7:463058-463080 CTGTATCAGGGCCAGGCCAGGGG - Intergenic
1019649933 7:2151419-2151441 CTGAAACAGCAGGAGGCCAGTGG + Intronic
1021340514 7:19457943-19457965 CAGTATCAACAGCAGCTCATTGG + Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1022650434 7:32269063-32269085 CTGTGGCAGTAGCAGCACAGAGG + Intronic
1023123484 7:36932919-36932941 CTGTCTCTGCAGCACCCCAGAGG - Intronic
1024620990 7:51157498-51157520 CTGTCCCATCAGCAGACCAGGGG - Intronic
1028270052 7:88777236-88777258 CAGAATCAGCACCAGGCCAGTGG - Intronic
1033298181 7:140160423-140160445 CTGAATCAGCAGCTGCCCTGGGG + Intronic
1033845578 7:145427910-145427932 GTGTATCAGCAGAAACCAAGTGG + Intergenic
1034412056 7:150947003-150947025 CTGTAGCAGCTGCAGGACAGTGG + Exonic
1034422395 7:150996489-150996511 CTGACTCAGCAGCTGCTCAGGGG - Exonic
1035673980 8:1442135-1442157 CTGAACCCACAGCAGCCCAGAGG - Intergenic
1037034971 8:14154931-14154953 CTGTCTCAGCTGTCGCCCAGTGG + Intronic
1038494207 8:27990180-27990202 CTGGTCCAGCAGGAGCCCAGGGG + Intronic
1039211435 8:35219805-35219827 CTGCATCAGCTGCAGGCCATGGG - Intergenic
1039315160 8:36363591-36363613 CTGACTCAGTAGCAGTCCAGAGG - Intergenic
1041122420 8:54600505-54600527 TCGTATCAGAAGAAGCCCAGAGG - Intergenic
1041803390 8:61823789-61823811 CTTTATCATCTGTAGCCCAGGGG - Intergenic
1048119392 8:131563124-131563146 ATGTGTCAGCAGCAGCACATGGG + Intergenic
1048284930 8:133134244-133134266 CTGAGTGAGCAGGAGCCCAGAGG + Intronic
1048912871 8:139152854-139152876 CAGAAACAGCAGCAGCACAGAGG - Intergenic
1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG + Intronic
1049428078 8:142546142-142546164 GTGTGTCTGCAGTAGCCCAGAGG + Intergenic
1049622076 8:143602947-143602969 ATGTTTCATCCGCAGCCCAGTGG - Exonic
1057078305 9:92152786-92152808 CTGTATCTTCAGGAGACCAGTGG - Intergenic
1062687912 9:137825462-137825484 CTGTATGAGAAACTGCCCAGAGG + Intronic
1203740194 Un_GL000216v2:171561-171583 CTCAACCAGCAGCAGGCCAGAGG - Intergenic
1186989748 X:15054856-15054878 CTGTATCAGCTGCAGTACATAGG - Intergenic
1190388847 X:49911829-49911851 CTGTAGCATCAGCAGCCCCTGGG + Intergenic
1193644274 X:84047633-84047655 CAGTGTCAGCAGCAGCCCCAGGG + Intergenic
1195687988 X:107602686-107602708 CTGCAGCAGCAGCAGCCCTGAGG + Exonic
1197936659 X:131746844-131746866 ATGAAGCAGCAGCTGCCCAGCGG + Intergenic
1199979712 X:152914253-152914275 CTGTACCTGCTGCTGCCCAGCGG - Intergenic