ID: 1078533026

View in Genome Browser
Species Human (GRCh38)
Location 11:12151628-12151650
Sequence GAAGTTGGTGAGCCACAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078533026_1078533031 24 Left 1078533026 11:12151628-12151650 CCTTCTTGTGGCTCACCAACTTC 0: 1
1: 1
2: 0
3: 10
4: 155
Right 1078533031 11:12151675-12151697 TGCCCTGGCAGAAGTAGAAAAGG 0: 1
1: 0
2: 1
3: 29
4: 299
1078533026_1078533028 -5 Left 1078533026 11:12151628-12151650 CCTTCTTGTGGCTCACCAACTTC 0: 1
1: 1
2: 0
3: 10
4: 155
Right 1078533028 11:12151646-12151668 ACTTCAACACACAGTTTCCAAGG 0: 1
1: 0
2: 2
3: 27
4: 225
1078533026_1078533029 9 Left 1078533026 11:12151628-12151650 CCTTCTTGTGGCTCACCAACTTC 0: 1
1: 1
2: 0
3: 10
4: 155
Right 1078533029 11:12151660-12151682 TTTCCAAGGTCTTTGTGCCCTGG 0: 1
1: 0
2: 1
3: 20
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078533026 Original CRISPR GAAGTTGGTGAGCCACAAGA AGG (reversed) Intronic
900471871 1:2859095-2859117 GAAGAAGGTGATCCACAAAAAGG + Intergenic
901458624 1:9378139-9378161 GAAGCTGCTGGGCCACAAGGAGG - Intergenic
901731113 1:11280476-11280498 GAAGTTGCTGAGCAAGAAGTTGG - Intronic
901957322 1:12795943-12795965 GACGGTGATGAGCCACAGGAAGG - Exonic
901965341 1:12861726-12861748 GACGGTGATGAGCCACAGGAAGG - Exonic
901973718 1:12928200-12928222 GACGGTGATGAGCCACAGGAAGG - Intronic
901988699 1:13095205-13095227 GACGGTGATGAGCCACAGGACGG + Intergenic
901993114 1:13131562-13131584 GACGGTGATGAGCCACAGGACGG - Intergenic
902011460 1:13273567-13273589 GACGGTGATGAGCCACAGGAAGG + Intergenic
902020593 1:13342559-13342581 GACGGTGATGAGCCACAGGAAGG + Exonic
902924264 1:19685466-19685488 TATGTTGGTGAGCAACAAGTAGG + Intronic
904337185 1:29805501-29805523 GCACTTGGGAAGCCACAAGAAGG + Intergenic
904683627 1:32245736-32245758 AAAGTTTGTGAACCACTAGAAGG + Intergenic
907690573 1:56660715-56660737 GAAATTGGTGAGTGACAGGATGG - Intronic
909192882 1:72576687-72576709 GAAGTTGCTCAGCCACAAGCTGG + Intergenic
909314129 1:74194634-74194656 AAAGGTGGTGAGCCAGAAGATGG + Intronic
910198983 1:84678312-84678334 GAAGTGAGTGTGCCACAAGTGGG - Intronic
912069529 1:105792014-105792036 GAAGTTGGTGAGCAGAAAAATGG + Intergenic
912375900 1:109209773-109209795 GAAGGAAGGGAGCCACAAGAAGG + Intergenic
912450537 1:109765140-109765162 GAAGCTGAAGGGCCACAAGATGG - Intronic
914360357 1:146930393-146930415 GCAATTGTGGAGCCACAAGATGG + Intergenic
914493389 1:148169504-148169526 GCAATTGTGGAGCCACAAGATGG - Intergenic
922504538 1:226118897-226118919 CAAGTTGGAGAGCCAGAACAAGG + Intergenic
923340912 1:233006318-233006340 GAAGTGGGTGAGGAACCAGAAGG - Intronic
923940557 1:238820034-238820056 TACATTGGTGAGCCACTAGAAGG - Intergenic
924948905 1:248864820-248864842 GAAGTAAATGAGCCACAAAAAGG - Intergenic
1063638595 10:7809612-7809634 ACAATTGGTGAGCCACAAGAGGG + Intergenic
1064698940 10:17998622-17998644 TAAGTTAGTGAACCACAGGAAGG + Intronic
1065553990 10:26895698-26895720 GAAGTTGGTGAGTCACTTGAAGG + Intergenic
1065599327 10:27352916-27352938 GAATTTGGTGAGTCACTTGAAGG - Intergenic
1070219888 10:74430341-74430363 GAAGTGGGTGGGCAACATGAAGG - Intronic
1071125927 10:82334505-82334527 GAATTAGGTGAGCAAAAAGATGG + Intronic
1072318864 10:94229397-94229419 GAAGTGGGTGATCCAAGAGAGGG + Intronic
1075038611 10:119089765-119089787 TGAGTTGGTGAACCACAAGAGGG - Intergenic
1075564811 10:123495464-123495486 GAAGTTGGTGAGTCCTCAGATGG - Intergenic
1077844195 11:6006902-6006924 GAATTTGGTGAGTCTCAAGGTGG - Intergenic
1078533026 11:12151628-12151650 GAAGTTGGTGAGCCACAAGAAGG - Intronic
1082682324 11:56190721-56190743 GAAGATGGTGACCCACATCATGG + Intergenic
1083536282 11:63469435-63469457 GAATATGGAGAGACACAAGATGG + Intronic
1085450213 11:76627362-76627384 GAAGTTGCTCAGCTAGAAGAGGG + Intergenic
1087307918 11:96506053-96506075 GAAGGTAGTGAGCCATGAGAAGG - Intronic
1087703682 11:101465913-101465935 AAAGATGGTGAGAAACAAGATGG - Intronic
1089051370 11:115548894-115548916 GGAGATGGTGAGCCAGAGGAAGG + Intergenic
1090092822 11:123714141-123714163 TAAGATGGGGAGCCACTAGAGGG - Intergenic
1093336945 12:17916808-17916830 TAATTTGGTGAGCCAAAATATGG - Intergenic
1095644286 12:44524451-44524473 GAAGTGGGTTAGAGACAAGATGG + Intronic
1096167793 12:49438454-49438476 GAAGTTGCTGGGTCATAAGATGG + Intronic
1096330192 12:50705061-50705083 GAACTTGATGAGCCAGAGGATGG + Intronic
1098192230 12:67961645-67961667 AAAATTCTTGAGCCACAAGAAGG - Intergenic
1101758809 12:107642593-107642615 GAAGTTGGTGAGCCACAGGAAGG + Intronic
1104264627 12:127219999-127220021 GATGTTGCTCAGCCACAGGACGG - Intergenic
1104398185 12:128453432-128453454 AAAGCTGGTGAGACACAGGAAGG - Intronic
1104462856 12:128969558-128969580 GACGCGGGTGAGCCACAAGGTGG + Intronic
1106844802 13:33726747-33726769 GAAGTTGGATAACCACAAAATGG + Intergenic
1108504234 13:51096288-51096310 GATGGTGGTGAGAGACAAGAGGG + Intergenic
1112068929 13:95826275-95826297 GAAGTTGGTCAACCACAGTAAGG + Intronic
1112819969 13:103321634-103321656 GAAGTTGGGGAGGGACAGGAGGG + Intergenic
1121990554 14:98552847-98552869 GAAATTGGTCAGCCCCGAGAGGG + Intergenic
1125490747 15:40146922-40146944 GAAAGTGTTGGGCCACAAGAAGG - Intergenic
1125676022 15:41503009-41503031 GAAGTCGATGAGCCACACGCCGG - Exonic
1129919428 15:79307418-79307440 GAAGTTTGTGAGTCTCAGGAGGG + Intergenic
1133201486 16:4206970-4206992 GAAGGTGGAGCGCCACAGGAAGG - Intronic
1134019994 16:10914998-10915020 AAAGCTGGGGAGCCCCAAGATGG + Intronic
1136139436 16:28279140-28279162 GAGGTTGCAGAGCCCCAAGATGG + Intergenic
1136745256 16:32582180-32582202 CAAATTGCTGAACCACAAGAAGG - Intergenic
1140183584 16:72746008-72746030 GAAGATGGTGATCCACAACTCGG + Intergenic
1203047383 16_KI270728v1_random:841384-841406 CAAATTGCTGAACCACAAGAAGG - Intergenic
1142979085 17:3661272-3661294 GAAATTGGTGAGTCTCAAGTAGG - Exonic
1143595306 17:7910444-7910466 GGAGTTGCTGAGCGACATGAAGG + Exonic
1144785629 17:17830019-17830041 GGAGTTGGTGAGAGACAGGATGG - Intronic
1148484428 17:47981607-47981629 GAAGATGGAAAGCCACAGGAAGG + Exonic
1148805506 17:50261911-50261933 GAAGCAGGTGAGGCCCAAGAAGG + Intergenic
1150656383 17:67042475-67042497 GTAGCTGGGGAGCCAGAAGAGGG - Intergenic
1151745230 17:76008332-76008354 GAAGCTGCTCAGCCAGAAGACGG - Exonic
1151745422 17:76009238-76009260 GGAGGTGGTGCGCCACGAGAAGG - Exonic
1153492016 18:5659436-5659458 CTAGGTGCTGAGCCACAAGAAGG + Intergenic
1153741765 18:8137491-8137513 GAAGTTGGGGAGCCATGGGAAGG - Intronic
1153766034 18:8376018-8376040 GTAGTTGGTTAGCCAGAACAAGG - Intronic
1156685231 18:39637121-39637143 GAAGTGGGTGGGCAACCAGAGGG - Intergenic
1156795191 18:41036289-41036311 CAAGTTCCTGAGCCACAAAATGG - Intergenic
1157915817 18:51662739-51662761 GATGTTGGCGAGACAGAAGACGG + Intergenic
1158824144 18:61195452-61195474 GAGGTTGTGGAGCCACATGATGG - Intergenic
1165654125 19:37518460-37518482 GATATTGGTGAGCCACAGAATGG - Intronic
1168587105 19:57602520-57602542 GAAGGGTGGGAGCCACAAGAGGG + Intronic
926008461 2:9390451-9390473 GAGGTTTGTGAGGCAGAAGAAGG + Intronic
931198764 2:60077194-60077216 GAAGTCTGTGAGCAACATGAAGG - Intergenic
932038857 2:68277201-68277223 GAAGTTGCTGAGCCAGAAAAAGG + Intergenic
932138047 2:69247796-69247818 GACGTTGCTGAGCAACGAGATGG + Exonic
932641998 2:73458121-73458143 TAAGATGGTGAAACACAAGATGG - Intronic
933422127 2:82062080-82062102 GAGGGTGGTGAGCCTAAAGAGGG - Intergenic
934295437 2:91739250-91739272 GAAGATGGTGAGGCAGAAGGTGG - Intergenic
934773833 2:96924713-96924735 GAAGTGGGTGAGACAGCAGAGGG - Intronic
935360327 2:102241133-102241155 TAAGTTGGAGAGCCCCGAGAAGG - Intergenic
937476880 2:122223546-122223568 GAAGTTGGTTGGACACACGATGG + Intergenic
939787929 2:146539470-146539492 GAAGATGCAGAGCCACACGATGG + Intergenic
946219108 2:218211265-218211287 GATGTAGGGGAGCCAGAAGAGGG + Intergenic
946278640 2:218649833-218649855 CAAGGGGGTGAGCCAAAAGAAGG + Intronic
947500561 2:230668073-230668095 GGAGTTGGTGACCCAGAAGGAGG + Intergenic
948385325 2:237577289-237577311 GATGCTGGTGGGCAACAAGACGG - Exonic
1172444970 20:34988081-34988103 GAAGCTGTTGAACTACAAGAGGG - Exonic
1173385815 20:42587047-42587069 GAGGATGGTGAGGCAGAAGATGG - Intronic
1174946795 20:54995090-54995112 GAGATTCGTCAGCCACAAGAAGG - Intergenic
1175115091 20:56676551-56676573 GAAGTTGGAGAGCAACGGGATGG + Intergenic
1175475920 20:59274243-59274265 GACACTAGTGAGCCACAAGAAGG + Intergenic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1179633091 21:42690771-42690793 GAAGTTGGTGAGGCATAAGTTGG - Intronic
1182017254 22:27051151-27051173 GAAGCAGGTGAGGCAGAAGAAGG + Intergenic
1183769169 22:39908616-39908638 GAAGTTGGAGACTCACAAGAGGG + Intronic
949866154 3:8549192-8549214 GAAGTTGGTGAGGTACAAGCTGG + Intronic
955564461 3:60228945-60228967 GAAGTTGCTGAGCCACTAAGTGG + Intronic
958123403 3:89323852-89323874 GAAGTTGGTTAGCAAAAATATGG - Intronic
964218484 3:154317094-154317116 GAAGTTGGGGAGAGACAAAAAGG + Intronic
966740728 3:183231118-183231140 TAAGTAGGTGAGCCACTAAAAGG - Intronic
969464325 4:7345916-7345938 GAAGTTGGCCAGAGACAAGATGG - Intronic
969944055 4:10764624-10764646 GAAGTTGATGGGCAACAATATGG + Intergenic
972382385 4:38531466-38531488 GAAGCTGGTCAGTGACAAGATGG - Intergenic
973838166 4:54831904-54831926 GAAGTGTGTGAGCTACAAAATGG + Intergenic
979205708 4:118034384-118034406 CAAGCTGGTGAGGCACTAGAGGG - Exonic
984193816 4:176634790-176634812 GAAGTTGCTGAGCACCAACAAGG + Intergenic
988326843 5:29779564-29779586 GAAGTTTGTCAGGCACATGAAGG + Intergenic
988681458 5:33488333-33488355 GAAGTTCCTGAGGCACAAGGAGG - Intergenic
990498136 5:56369105-56369127 GAAGTAGCTGAGCAGCAAGACGG + Intergenic
992861097 5:80911164-80911186 CAAGATGGTGTGACACAAGACGG + Intergenic
994085067 5:95749687-95749709 GAAGCTGGAGAGCAAAAAGATGG + Intronic
995205466 5:109474968-109474990 GAAGCTGGTGTGGCTCAAGATGG + Intergenic
1003743990 6:8978792-8978814 GAAATTGGAGTCCCACAAGAAGG - Intergenic
1004468564 6:15907877-15907899 TAAGTTTGTGAGCCAAAATAAGG - Intergenic
1008279915 6:49584641-49584663 GAAGTTGATGAGAAAGAAGATGG + Intergenic
1008564824 6:52756850-52756872 GAAGTACGTGAGACACAATAGGG + Intronic
1014070120 6:117171650-117171672 GAAGTTGGGGAGCAAGGAGAAGG + Intergenic
1016116766 6:140296058-140296080 GAAATTAGTGAGGCACAAAAAGG + Intergenic
1016862074 6:148730924-148730946 GAAGGTGGTGAGGCACAACTGGG + Intergenic
1017722233 6:157251742-157251764 GGAGCTGGGGAGCGACAAGAGGG - Intergenic
1021505501 7:21380093-21380115 GAAGTTTCTGTTCCACAAGAAGG - Intergenic
1021938035 7:25651078-25651100 GAAGATGCTCAGCCACGAGATGG - Intergenic
1024611109 7:51065176-51065198 GAGGTAGGTAAGACACAAGATGG + Intronic
1030699302 7:112621397-112621419 CAAGATGGTGAGACCCAAGATGG - Intergenic
1031931374 7:127689393-127689415 GAACTTGGTCAGCTCCAAGAAGG - Intronic
1037290242 8:17342633-17342655 GAAGTTGGAGAACCACAGAATGG + Intronic
1037829729 8:22180297-22180319 GGGGTGGGTGAGCCAGAAGATGG + Intronic
1038147813 8:24914276-24914298 GGAGATGGTGAACCACGAGAAGG + Exonic
1038903195 8:31867218-31867240 GAATGTGGTAAGCCACAAAATGG + Intronic
1041085571 8:54253400-54253422 GGATTTGGGGAGCCAGAAGAGGG + Intergenic
1041941738 8:63395863-63395885 GAATTTGTTGACCCACAGGAAGG - Intergenic
1044625479 8:94232344-94232366 GAAGGTGGAGAGACATAAGAGGG + Intergenic
1047463652 8:125091917-125091939 GAAATTGGGGTGCCACCAGACGG + Exonic
1049232116 8:141489847-141489869 GGAGTGGGTGAGCCATCAGAGGG + Intergenic
1050335186 9:4583611-4583633 GAAGCTGGTAAGACACAGGACGG - Intronic
1053360823 9:37485716-37485738 GAAGGTGCTGAGCCGGAAGAAGG + Intergenic
1058551815 9:106122954-106122976 GAGGTTGGTGAGCCTGGAGAGGG + Intergenic
1058769333 9:108215134-108215156 GAATTTGGGGAGCCTCAATAAGG - Intergenic
1059371481 9:113843013-113843035 GAGCTTGGTGAGGCAGAAGATGG - Intergenic
1060945160 9:127566259-127566281 GAAGTGGGTGGGCCACTCGATGG - Intronic
1203490854 Un_GL000224v1:103148-103170 GAAGTTGGGGATCCAGATGATGG + Intergenic
1203503478 Un_KI270741v1:45026-45048 GAAGTTGGGGATCCAGATGATGG + Intergenic
1187345670 X:18461233-18461255 GAAGTTGCTGGGCCACAGCATGG + Intronic
1189648395 X:43159688-43159710 AAAGTTGGTAAGCAGCAAGAAGG + Intergenic
1190728473 X:53208264-53208286 GAAGATGATGAGCCACGAGCAGG + Intronic
1192065360 X:67879567-67879589 TAAGTTAGTGAGACACAAGCTGG + Intergenic
1196824431 X:119730104-119730126 AAACTTGGTGAGTCACAAGGGGG - Intergenic
1199983503 X:152934150-152934172 GAAAATGGAGAGCCACTAGAAGG - Intronic
1200709455 Y:6470477-6470499 GAAGTTGTTGAGCCAGACCAAGG + Intergenic
1200910968 Y:8531091-8531113 GAAGTTGTTGAGCCAGACGTGGG - Intergenic
1200931654 Y:8702317-8702339 GAAGTAGTTGAGCCAGAAGCAGG + Intergenic
1201024657 Y:9694231-9694253 GAAGTTGTTGAGCCAGACCAAGG - Intergenic
1201949186 Y:19544954-19544976 GAAATTAGTGGGCCAGAAGATGG - Intergenic
1202147458 Y:21814721-21814743 GAAGTGGGAGAGCCTCAAGAGGG + Intergenic