ID: 1078534252

View in Genome Browser
Species Human (GRCh38)
Location 11:12160498-12160520
Sequence AAGGTTCAGGATTCGTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078534252 Original CRISPR AAGGTTCAGGATTCGTGAGG AGG (reversed) Intronic
900221505 1:1511808-1511830 AAGGTTCTCGATCCGTGCGGCGG - Intergenic
900885679 1:5413782-5413804 AATGTTCAGGATGCTGGAGGGGG - Intergenic
900885707 1:5413943-5413965 AATGTTCAGGATGCTGGAGGGGG - Intergenic
902492771 1:16797255-16797277 AAGCCTCAGGATCAGTGAGGAGG - Intronic
903390606 1:22961065-22961087 AATGTTCAGGCTAGGTGAGGCGG - Intronic
906757180 1:48329880-48329902 AAGGTGCAGGATGGGTGACGGGG - Intronic
910857348 1:91708755-91708777 GAGGTGCAGGCTTCGTCAGGAGG + Exonic
915661488 1:157409258-157409280 AAGGTTCTGGGTCTGTGAGGTGG + Intergenic
918311537 1:183288900-183288922 AAGGGTCAGGATATGTGAGAAGG + Intronic
1063937721 10:11096353-11096375 AAGTGTAAGGATTCGTGAAGGGG - Intronic
1064286674 10:13997538-13997560 TAGGTTCAGGATGTCTGAGGTGG + Intronic
1065088075 10:22200295-22200317 ACAGTTCAGGATTTCTGAGGAGG + Intergenic
1065733008 10:28726362-28726384 CAGATTCATGATTCATGAGGAGG + Intergenic
1067460611 10:46455474-46455496 AAGCTTCAGGATTAGACAGGGGG + Intergenic
1067626581 10:47929129-47929151 AAGCTTCAGGATTAGACAGGGGG - Intergenic
1073518866 10:104106284-104106306 AAGGTTCAGGATGCGTGCCAGGG + Intergenic
1077551674 11:3203255-3203277 AAGGGTCTGGAATCGTGTGGTGG - Intergenic
1078534252 11:12160498-12160520 AAGGTTCAGGATTCGTGAGGAGG - Intronic
1079559051 11:21799255-21799277 AAGATGCAGGATTCCTGAAGAGG + Intergenic
1081458703 11:43251062-43251084 AAGGTTAAAGATTTGTGATGTGG - Intergenic
1088472522 11:110201627-110201649 GAGGCTCAGGATTTGTGAAGCGG + Intronic
1089398673 11:118152283-118152305 GAGGTTCAGGATGCTGGAGGAGG - Intronic
1090127001 11:124096896-124096918 AAGGTTGAGGGTAGGTGAGGTGG + Intergenic
1091035650 11:132230734-132230756 AATGCTCAGGATTGGTGTGGTGG + Intronic
1095062351 12:37713055-37713077 AAGGTTCAGGATGGGCGTGGTGG - Intergenic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1097637227 12:62137716-62137738 AAGCTGCAGGACTAGTGAGGAGG - Intronic
1099708639 12:86191011-86191033 AAAGTTCAACATTTGTGAGGCGG - Intronic
1112516560 13:100058376-100058398 AAGTATCAGGATTGGTCAGGAGG + Intergenic
1129062130 15:72868583-72868605 AAGGACCAGAATTTGTGAGGGGG - Intergenic
1129163368 15:73760407-73760429 AAGGTTCAGGGTACGTGTTGGGG - Intergenic
1130049077 15:80468271-80468293 GAGGTTCAGGGTTGGGGAGGAGG - Intronic
1135831290 16:25776103-25776125 AAGGTACAGGAGTCAAGAGGAGG - Intronic
1136915750 16:34194916-34194938 AAGGTTCAGGCTGGGTGCGGTGG + Intergenic
1137678443 16:50316618-50316640 ACGGCTCAGCATTTGTGAGGGGG - Exonic
1143407340 17:6686151-6686173 AAGGTTCGGTAGTCCTGAGGAGG + Exonic
1149506360 17:57197229-57197251 AAGAAGCAGCATTCGTGAGGTGG + Intergenic
1153012486 18:551681-551703 AGGGTTGAGGAGTCGTGAGGGGG - Intergenic
1161802919 19:6425777-6425799 ACGGTTCTGGACTCGTGAGTGGG - Intergenic
1162349020 19:10137699-10137721 AAGGCTGAGGACTCGGGAGGAGG + Intronic
1165465391 19:35971683-35971705 AAGGTTCTGGATACCTGGGGTGG - Intergenic
1167344002 19:48933887-48933909 AGGGTTCAGGACTAGTGAGTGGG + Intronic
1167377090 19:49118120-49118142 AAGGGTCAGGATCCCAGAGGAGG - Intronic
929269630 2:39959350-39959372 CAGGTCCAGGAATCGAGAGGCGG - Intergenic
929826559 2:45313451-45313473 AAGGGTTAGGATTTGGGAGGAGG + Intergenic
930881832 2:56279003-56279025 AAGGATCAACATTCTTGAGGTGG + Intronic
931126024 2:59277358-59277380 AATGTTCAGTATTGGAGAGGGGG - Intergenic
932591879 2:73072244-73072266 AATGTTCAGGGGTCGGGAGGCGG - Intronic
942816968 2:180063336-180063358 GTGGTTCAGGGTACGTGAGGGGG - Intergenic
947256412 2:228169968-228169990 AACATTCATGATTCATGAGGAGG + Intronic
1168976841 20:1973095-1973117 AGGGCTGAGGATTCCTGAGGAGG - Intergenic
952609811 3:35194759-35194781 AAGGTCCAGGATTTGTGCAGTGG + Intergenic
956524659 3:70144512-70144534 AAAGTTCAGGATTCCACAGGGGG - Intergenic
958076846 3:88691202-88691224 AAGGTTCAGCATGGCTGAGGAGG + Intergenic
965596598 3:170417411-170417433 AAGTCTCATGATTGGTGAGGAGG + Intergenic
970248664 4:14091479-14091501 AAGGGTCAGCTTTGGTGAGGTGG + Intergenic
975193102 4:71489690-71489712 AAGGTTCAGGATAGGAGAGCCGG - Intronic
976733949 4:88291827-88291849 AAGGTGTTGGATTCGTTAGGAGG - Intergenic
977525589 4:98142208-98142230 AAGGTTTAGGTTTCTTGGGGTGG - Intronic
979823911 4:125209346-125209368 ATGGTCCAGGACTCTTGAGGAGG + Intergenic
981444465 4:144819664-144819686 AAGGTTCAGCATTGCTGAGTGGG + Intergenic
990009217 5:50975731-50975753 AAGGTTAAGGATTTGTGGGAGGG + Intergenic
998797552 5:145835610-145835632 AAGGTCCAGGTTTCCTGGGGCGG - Intergenic
1002953287 6:1837520-1837542 AAAATTCAGGATTCGGGACGGGG - Intronic
1005606132 6:27479261-27479283 AAAGTTCAGGATGCGTCAAGTGG - Intergenic
1013936744 6:115605333-115605355 AAGGCTCAAGATTTGAGAGGTGG - Intergenic
1014719003 6:124894901-124894923 AAGGTGGAGGATACGAGAGGAGG - Intergenic
1016039516 6:139417937-139417959 AAGTTTCAGGATGGGTGTGGTGG - Intergenic
1016995435 6:149959336-149959358 AAGGTACAGGAAACTTGAGGGGG + Intergenic
1017126631 6:151070815-151070837 AAGGTTAGGGATTCCTGAGATGG - Intronic
1017594630 6:156015370-156015392 AAGTTGCAGGATTGGTGGGGTGG - Intergenic
1020097507 7:5377071-5377093 GAGGTTCAGGACTTGGGAGGTGG - Intronic
1022020789 7:26398172-26398194 AAGGCCCAGGGTTCGGGAGGCGG + Intergenic
1023595741 7:41828114-41828136 AAGGGTCAGTATTAGTGAGCAGG + Intergenic
1024613872 7:51090737-51090759 AATGTTCTGGATTTGTGGGGAGG + Intronic
1026181031 7:68041197-68041219 AAGGATCAGAATTCATGGGGTGG - Intergenic
1027675690 7:81155000-81155022 AAGGTTCAGGATGCGTGGTAAGG - Intergenic
1028562834 7:92194268-92194290 AAGGTTAAGGATAGGTGTGGGGG - Intergenic
1028737460 7:94233399-94233421 AAAGTTCAGGATTGCTGAGTTGG + Intergenic
1028935217 7:96456511-96456533 CAGGTTCAGGAATCGAGGGGTGG + Intergenic
1031847185 7:126820524-126820546 AAGGTTCAGTTTTTGTCAGGTGG - Intronic
1037334099 8:17775377-17775399 AAGTTTCAGGATCCCGGAGGTGG - Intronic
1039377682 8:37052540-37052562 AAGGTTAAGGATATGTAAGGAGG + Intergenic
1051061656 9:13052634-13052656 AAGGTGCAGGATTGGGCAGGGGG + Intergenic
1054924969 9:70579923-70579945 ATGGCTCAGCATGCGTGAGGTGG - Intronic
1197865503 X:131012465-131012487 AAGTTTCAGGAATAGTAAGGAGG + Intergenic
1200070062 X:153524790-153524812 AAGCTTTAGGATTGCTGAGGTGG - Intronic
1200958284 Y:8972649-8972671 CAGGTTCAGAAATCATGAGGAGG - Intergenic
1201598283 Y:15696775-15696797 AAGATTCAGGTTGTGTGAGGTGG - Intergenic
1201705842 Y:16935829-16935851 AAGGTTCAATACTGGTGAGGTGG - Intergenic
1202335970 Y:23811447-23811469 AAGGTTTAGGATTCAGGATGAGG + Intergenic
1202534796 Y:25858620-25858642 AAGGTTTAGGATTCAGGATGAGG - Intergenic