ID: 1078538860

View in Genome Browser
Species Human (GRCh38)
Location 11:12197604-12197626
Sequence CACATAGGTTCCCCGAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 59}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078538860_1078538866 21 Left 1078538860 11:12197604-12197626 CCTGACTTCGGGGAACCTATGTG 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1078538866 11:12197648-12197670 GACCCAACCGCTACCCAGAGAGG 0: 1
1: 0
2: 1
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078538860 Original CRISPR CACATAGGTTCCCCGAAGTC AGG (reversed) Intronic
904605961 1:31697852-31697874 CACTCAGGTTCCCAGAAGGCAGG + Intronic
1063281179 10:4631222-4631244 AACATATGCTCCCTGAAGTCTGG + Intergenic
1063905176 10:10774222-10774244 CACAAAGGCTCCTTGAAGTCAGG - Intergenic
1068995004 10:63192340-63192362 CAGATGGATTACCCGAAGTCAGG + Intronic
1069407831 10:68121509-68121531 CTCATTGTTTCCCCGATGTCTGG - Exonic
1074012274 10:109494592-109494614 CACACAGGTGCTCTGAAGTCAGG - Intergenic
1076472112 10:130726343-130726365 CATATAGGGTCCCCGATGTTTGG + Intergenic
1078538860 11:12197604-12197626 CACATAGGTTCCCCGAAGTCAGG - Intronic
1083431610 11:62616296-62616318 CACATGGGTTCCCAGAACTCGGG + Intronic
1084792471 11:71483287-71483309 CACACAGCTTCCCTGAAATCTGG - Intronic
1092859366 12:12706924-12706946 GACAAAAGTTACCCGAAGTCAGG + Intergenic
1093766452 12:22968852-22968874 AACGTAGGTTCTCCGAAGGCAGG + Intergenic
1093780283 12:23127792-23127814 CACTGAGGTTCCACGAAGACAGG + Intergenic
1094351368 12:29529372-29529394 CACATAGTGACCCCGATGTCAGG - Intronic
1104029495 12:125054096-125054118 CACAGTGGCTCCCCGAGGTCAGG - Intergenic
1112041692 13:95553367-95553389 CCCCTACGTTCCCCGAAGGCTGG + Intronic
1120036801 14:79706978-79707000 CCCGTAGGGTACCCGAAGTCCGG - Intronic
1122295601 14:100704009-100704031 CAAACAGGTTCCCCGAGTTCAGG - Intergenic
1122664159 14:103317163-103317185 CACATTGATTCCCTGAACTCAGG + Intergenic
1126384367 15:48078605-48078627 ATCATAAGTTCCCTGAAGTCAGG - Intergenic
1137423888 16:48360184-48360206 CACTTAGGTGCCTGGAAGTCTGG + Intronic
1138032198 16:53568528-53568550 TGCATAGGTTCAACGAAGTCTGG + Intergenic
1138844929 16:60554130-60554152 CACTTAGGGTCCCCGAATCCAGG - Intergenic
1141383176 16:83594480-83594502 CACAGAGGCTCCACGAAGGCAGG - Intronic
1145965975 17:28917549-28917571 CACATAGGTTCCCTCAATTAGGG + Intronic
1147175363 17:38652748-38652770 CACTTAGGTTCCCCAGAGCCTGG - Intergenic
1157521142 18:48346435-48346457 AACATGGGTTCCCCCAAGGCTGG + Intronic
1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG + Exonic
926009882 2:9399565-9399587 CACATTGGTTCCCAGAAGCAGGG + Intronic
929862908 2:45694506-45694528 CACATAAGTTCCATGAAGACAGG - Intronic
930852320 2:55974252-55974274 CACATTAGTTCCCTGAACTCTGG - Intergenic
948679005 2:239619502-239619524 CACATAGCTTCCCAGGAGTCTGG + Intergenic
1174324841 20:49770949-49770971 CACTGAAGTTCCCAGAAGTCAGG - Intergenic
1179009091 21:37540070-37540092 CACATAGGTTCTTCTTAGTCTGG - Intergenic
1181375856 22:22457460-22457482 CCCATAGGTTCCCTGGACTCTGG - Intergenic
1184340061 22:43881134-43881156 CACACAGGACCCCCCAAGTCTGG + Intronic
1184548333 22:45189239-45189261 CCCGTAGGGTACCCGAAGTCTGG - Intergenic
949099575 3:127782-127804 CCCACAAGTTCCTCGAAGTCAGG + Intergenic
951799761 3:26582790-26582812 TACAGAGGTTCCCTGAAGTTGGG + Intergenic
954913298 3:54127121-54127143 AACATTGGTTCCCCGAATGCAGG - Intronic
955419793 3:58724789-58724811 CCCGTAGGGTACCCGAAGTCCGG - Intronic
959739069 3:109695220-109695242 CCCATAGGTCCCCCGATGGCAGG + Intergenic
961642494 3:128373455-128373477 CACAGAGGTTCCCTGGAGACAGG - Intronic
972048036 4:34693776-34693798 CACATAGGTTCCCTGACCTGTGG - Intergenic
980395075 4:132202449-132202471 CACATAGGTTCCCGGAAGATTGG + Intergenic
984187831 4:176567769-176567791 AACATTGGTTCCCCGAATTCTGG + Intergenic
989533679 5:42538844-42538866 AACAAAGGTTCCAAGAAGTCTGG - Intronic
992586453 5:78245047-78245069 CCCATAGGGTACCCAAAGTCCGG + Intronic
993971864 5:94429715-94429737 CCTACAGGTTCCCCGATGTCAGG + Intronic
998501357 5:142635694-142635716 CACATAGGTTCCCCCAACAAAGG + Intronic
999484557 5:151982802-151982824 AACAAAGCTTCCCAGAAGTCTGG - Intergenic
1007810296 6:44480857-44480879 ACCATAGGTTCCCCCAAGGCTGG - Intergenic
1013808462 6:114018319-114018341 CTCGTAGGGTACCCGAAGTCCGG - Intergenic
1022088959 7:27095651-27095673 CCCCCAGGTTCCCGGAAGTCTGG + Exonic
1022194193 7:28048577-28048599 CATATAGGAACCCAGAAGTCTGG - Intronic
1023313684 7:38913429-38913451 CACATAGGTTGCCCCACTTCTGG - Intronic
1032527896 7:132593704-132593726 CACATGGGCTCCCTGAAGACAGG + Intronic
1032714342 7:134492137-134492159 CACTTAGGTTCTACAAAGTCTGG - Intergenic
1034533300 7:151710784-151710806 CAAATAGGCTCCACGAAGCCAGG + Intronic
1035382933 7:158451751-158451773 CACATAACTTCCCAGGAGTCAGG + Intronic
1037945169 8:22985114-22985136 CCCATAGGGTACCCAAAGTCTGG + Intronic
1044691282 8:94881794-94881816 CAAATAAGTACCCAGAAGTCTGG - Intronic
1047564914 8:126033624-126033646 CACATTGGTTCCCTGAACTGTGG - Intergenic
1196051132 X:111305572-111305594 CACAGAGGTTACCAGAAGCCGGG - Intronic