ID: 1078540784

View in Genome Browser
Species Human (GRCh38)
Location 11:12211446-12211468
Sequence AGTGAGAATCAGCATGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 263}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078540781_1078540784 13 Left 1078540781 11:12211410-12211432 CCCAAGGTTGTCACTAAAAGGGA 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1078540784 11:12211446-12211468 AGTGAGAATCAGCATGAGGCTGG 0: 1
1: 0
2: 1
3: 23
4: 263
1078540782_1078540784 12 Left 1078540782 11:12211411-12211433 CCAAGGTTGTCACTAAAAGGGAT 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1078540784 11:12211446-12211468 AGTGAGAATCAGCATGAGGCTGG 0: 1
1: 0
2: 1
3: 23
4: 263
1078540779_1078540784 14 Left 1078540779 11:12211409-12211431 CCCCAAGGTTGTCACTAAAAGGG 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1078540784 11:12211446-12211468 AGTGAGAATCAGCATGAGGCTGG 0: 1
1: 0
2: 1
3: 23
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078540784 Original CRISPR AGTGAGAATCAGCATGAGGC TGG Intronic
900030755 1:370928-370950 AGGGAAAATCACCATCAGGCTGG - Intergenic
900051371 1:599602-599624 AGGGAAAATCACCATCAGGCTGG - Intergenic
901119411 1:6878522-6878544 TGAGAGGATCTGCATGAGGCAGG - Intronic
902519764 1:17009620-17009642 TAGGAGGATCAGCATGAGGCCGG - Intronic
904114477 1:28151472-28151494 ATTAAGATTCAACATGAGGCCGG - Intronic
905652431 1:39665499-39665521 GGTGAGCATGAGCATGAGGATGG - Exonic
906559927 1:46748876-46748898 AGTGAGCATGAGGATGGGGCAGG - Intergenic
907119061 1:51992607-51992629 AGTGAGGATGACCATGAGCCAGG - Intergenic
908308170 1:62846831-62846853 ATTGAGAACCAGCTAGAGGCAGG - Intronic
909842752 1:80349404-80349426 ACTGAGAATGAGCCTGAGGCTGG - Intergenic
910494760 1:87814462-87814484 AGTGTGCAGCAGCATGAGACTGG + Intergenic
914344632 1:146788053-146788075 AGTTAGAGTCAGAATGAGGTAGG - Intergenic
915036155 1:152927092-152927114 AGTAAGAGTAAGCATGAGGCTGG - Intergenic
917387267 1:174491044-174491066 AGGGAGATAGAGCATGAGGCAGG - Intronic
919799510 1:201344937-201344959 AATGGGAAGCAGCAGGAGGCAGG - Intergenic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
921598982 1:217087306-217087328 AATGTGAATCAGCATGAGAATGG - Intronic
922754270 1:228086217-228086239 ATTTTGAAACAGCATGAGGCTGG + Intronic
923127049 1:231041163-231041185 AGTGGGAGGCAGCAGGAGGCGGG - Intergenic
1063595181 10:7428586-7428608 AGAGAGAATAAGCATTAGGTTGG + Intergenic
1063697925 10:8355884-8355906 AGAGAGAAGCATCCTGAGGCAGG - Intergenic
1064004472 10:11689057-11689079 AGAGAGATTCAGCTGGAGGCTGG + Intergenic
1064015149 10:11765812-11765834 AGTGTGCATCAGCTTGGGGCCGG - Intergenic
1065170004 10:23017670-23017692 CAGGAGAATCAGCTTGAGGCTGG + Intronic
1065475646 10:26135450-26135472 AAGGAGAATCAACATAAGGCAGG + Intronic
1066200322 10:33137817-33137839 AGTGAGCATCAGGATGACTCAGG - Intergenic
1066307553 10:34161272-34161294 AGTGAGAATTAGCATGAAATGGG + Intronic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1067557436 10:47282682-47282704 AGTGAGCAGCAGCATGAGCTTGG + Intergenic
1067912832 10:50364419-50364441 AGTGAAAAGCAGGATGGGGCTGG - Intronic
1069053722 10:63821795-63821817 TGTGAGAAGCAGAAAGAGGCAGG - Intergenic
1070753637 10:78978121-78978143 AGTGAGCAGAGGCATGAGGCAGG - Intergenic
1071159034 10:82725159-82725181 AGTGAGATACAGAATGAAGCAGG + Intronic
1071356648 10:84803245-84803267 ATTGTGAATCAGCCTCAGGCAGG + Intergenic
1072318761 10:94228558-94228580 AGTGAGAACCCTCATGAGGATGG - Intronic
1072634949 10:97171890-97171912 AGTCAGAAGGAGCATGGGGCAGG - Intronic
1075408272 10:122209159-122209181 AGTGAGACTAGGCAAGAGGCAGG + Intronic
1076049605 10:127321804-127321826 AGAGTGAATGAGCAAGAGGCTGG + Intronic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078540784 11:12211446-12211468 AGTGAGAATCAGCATGAGGCTGG + Intronic
1079339429 11:19599777-19599799 TTTGAGAAACAGCATGAGGGAGG + Intronic
1079743058 11:24087697-24087719 AGTGAGAAGCAGCATATGGATGG + Intergenic
1081049156 11:38315888-38315910 GGTGAGAATCAGTATTATGCTGG + Intergenic
1081658750 11:44874971-44874993 AGTGAGAATCAGCATTAAATTGG + Intronic
1083669093 11:64290624-64290646 ATAGAGAATCAGCTTGAAGCTGG + Intergenic
1083882447 11:65555245-65555267 AGTGAGCTTCTGCCTGAGGCAGG - Intronic
1085958698 11:81433378-81433400 ACTGTGAAACAGCCTGAGGCAGG - Intergenic
1087161098 11:94948863-94948885 AGTGAGAGGCAAGATGAGGCAGG - Intergenic
1089932986 11:122333186-122333208 AGTGAAAAACAGAATGAGGTGGG - Intergenic
1090029191 11:123193608-123193630 AGTGATTATCAGCCTGAGGCTGG + Intronic
1090117912 11:123994451-123994473 AGTGAGGATGAGCATGAAGCAGG + Exonic
1090785168 11:130042262-130042284 AGTGAAAATAAGCACGAGGAAGG + Intergenic
1092802743 12:12186834-12186856 AGTGAGGATCAGGAGGAGGGAGG - Intronic
1095346198 12:41151392-41151414 ATTGAGAATCAGCATGACCTTGG - Intergenic
1095751829 12:45720965-45720987 AATTAGAATCTGCATGAGGTAGG - Intergenic
1096500083 12:52059321-52059343 AGAGAGAGCCAGCAGGAGGCTGG - Exonic
1099036347 12:77592178-77592200 AGTGAAAGTCAACATGGGGCTGG + Intergenic
1100857169 12:98767585-98767607 AGTGAGAATTAGCAAGGGTCTGG + Intronic
1101110761 12:101483432-101483454 ACTGTGAATCAGCCTCAGGCAGG - Intronic
1101215063 12:102572928-102572950 AGTGTGAGGCAGCATGGGGCAGG + Intergenic
1101408750 12:104452417-104452439 ACTGAGGAGCAGCAAGAGGCAGG + Intergenic
1101711974 12:107275968-107275990 AGACAGAATCAGAATTAGGCTGG + Intergenic
1106239478 13:27899420-27899442 ACTGAGAGACAGCAGGAGGCAGG - Intergenic
1106359999 13:29022284-29022306 AGTGAGGAGGAGCATGAGGATGG + Intronic
1106578389 13:30997206-30997228 AGTTAGAAGGAGCATGAGGTTGG + Intergenic
1106781785 13:33066430-33066452 ACTCAGAGTCAGCATGAGGCGGG - Intergenic
1107063716 13:36189086-36189108 AGGAAGAATCAGCATGAGCATGG - Intronic
1110048815 13:70867662-70867684 TGTAAGAATCAGCATAAGGATGG - Intergenic
1110407598 13:75168226-75168248 AGAGAAAAGCAGAATGAGGCAGG + Intergenic
1110659415 13:78041864-78041886 TTTAAGAATCAGCAGGAGGCTGG - Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113245138 13:108386798-108386820 AGAGAGAATCAGAATAAGGATGG - Intergenic
1115354315 14:32431125-32431147 AATTGGAATCAGCCTGAGGCTGG + Intronic
1116750962 14:48882943-48882965 AGTGAGAGACAGCAGCAGGCTGG + Intergenic
1117679293 14:58186868-58186890 GGTGAGAAACAGAAGGAGGCAGG + Intronic
1121405254 14:93715827-93715849 AGTGAGGAGAAGCCTGAGGCAGG + Intergenic
1121916535 14:97840846-97840868 ATTGAGAATCAAGATGATGCTGG - Intergenic
1122520540 14:102340569-102340591 ATTAAGAATCACCATCAGGCTGG - Intronic
1123993808 15:25704133-25704155 AGTGACACTCAGGATGAGCCAGG - Intronic
1124341584 15:28893372-28893394 AGCCAGAATCAGTAAGAGGCTGG - Intronic
1126485645 15:49177651-49177673 AGTGAGAATCACCAGGAGTGTGG + Intronic
1130867720 15:87946644-87946666 ACTGAGTATCAACATGAGCCAGG - Intronic
1131792493 15:95980336-95980358 AGTGAGACTCAGCATCTGACTGG - Intergenic
1131838465 15:96413105-96413127 AGTGAGAATCAGAGAGATGCAGG - Intergenic
1131898250 15:97057840-97057862 AGTGCTGATCATCATGAGGCAGG + Intergenic
1132142062 15:99404605-99404627 AGTCAGCATCAGCAAGAGACAGG - Intergenic
1135116759 16:19730250-19730272 ATTTAAAATCAGCAAGAGGCCGG - Intronic
1135791912 16:25404698-25404720 ATTGAGAAACATCATGTGGCAGG - Intergenic
1137725736 16:50655425-50655447 AGTGAGGATCAGAATGAGCAGGG - Intergenic
1138572384 16:57884232-57884254 GGTGAGGATCTGCATGAGCCCGG - Exonic
1139055099 16:63173843-63173865 AGTGAGAAGCAGGAGGAGGGAGG - Intergenic
1139086305 16:63590622-63590644 AGGGAAAGTCTGCATGAGGCAGG + Intergenic
1139296070 16:65902002-65902024 AGGGAGAAGCCCCATGAGGCAGG + Intergenic
1139306834 16:65993759-65993781 AGGGAGAGGCAGCATGAGCCTGG - Intergenic
1139989360 16:70927253-70927275 AGTTAGAGTCAGAATGAGGTAGG + Intronic
1140945777 16:79767093-79767115 AGAGAGATTCAACTTGAGGCTGG + Intergenic
1140992770 16:80230451-80230473 AATGAGAATCAGCATCAGGCTGG - Intergenic
1141459345 16:84168245-84168267 CGTCAGAGTCAGAATGAGGCTGG - Intronic
1142205668 16:88781873-88781895 AGTGACAATCAGCCTGAAGGAGG + Intronic
1143340444 17:6206869-6206891 AGTGGGATAGAGCATGAGGCAGG - Intergenic
1144048110 17:11471353-11471375 AGGGAGGACCAGCAGGAGGCTGG - Intronic
1144202398 17:12953289-12953311 AGTGTGAAGCAGCAGGAGCCAGG - Intronic
1144837336 17:18163584-18163606 TCTGAGAATCAGCCTCAGGCAGG - Intronic
1147681517 17:42250626-42250648 ATTGAAAATCATCACGAGGCCGG + Intronic
1149013060 17:51877480-51877502 AGAGAGAATCATCATGATGCGGG - Intronic
1151532067 17:74712932-74712954 AGTGAGTACCAGCAGAAGGCTGG - Exonic
1151742449 17:75992932-75992954 AGTAAGAATCAGAAGCAGGCAGG - Intronic
1152474771 17:80510791-80510813 AGTGAGGAGCAGCATGGGGTTGG + Intergenic
1152608689 17:81305298-81305320 TGTGGGAAACAGCAGGAGGCCGG + Intergenic
1152900109 17:82936220-82936242 AGAGAGAATCAGCAGCTGGCAGG - Intronic
1152948858 17:83214477-83214499 AGGGAAAATCACCATCAGGCCGG + Intergenic
1153096451 18:1411614-1411636 AGTGAGAATCAGAGGGAAGCAGG + Intergenic
1153802696 18:8685149-8685171 ACTTATAATCAGCATCAGGCAGG - Intergenic
1154132513 18:11749745-11749767 AGTGAGGCCCAGCTTGAGGCTGG + Intronic
1155615281 18:27715047-27715069 AGAGTGAATCAGCATCAGTCAGG + Intergenic
1156596702 18:38555792-38555814 AGTGAGGATCTGTATGTGGCAGG + Intergenic
1157245197 18:46047576-46047598 AGCGAGAATGTGCCTGAGGCAGG + Intronic
1157865642 18:51181685-51181707 TGTTTGAATTAGCATGAGGCTGG + Intronic
1158581569 18:58688852-58688874 ATTGAGAATCACCAAGAGGCCGG + Intronic
1160867591 19:1262620-1262642 AGTGAGAACCAGAAAGAGGGTGG - Intronic
1161373110 19:3924679-3924701 ATTGGGACTCAGGATGAGGCAGG - Exonic
1161618283 19:5284644-5284666 ACTAAAAAACAGCATGAGGCTGG + Intronic
1163120439 19:15214057-15214079 AGTGAGAACCAGCAGGAGTGAGG + Intergenic
1164038158 19:21471758-21471780 TGTGAGAATTGGCATGTGGCTGG + Intronic
1164076503 19:21823863-21823885 ATTTAGAATCAGCCTGAGGCTGG - Intronic
1164254011 19:23511421-23511443 TGTGAAAATCAGTAAGAGGCAGG + Intergenic
1166530857 19:43542762-43542784 GGTGGGAAGCAGCCTGAGGCAGG - Intergenic
1166982034 19:46636548-46636570 AGGGACAGTGAGCATGAGGCTGG - Intergenic
1167663973 19:50812490-50812512 AGTGAGGATCATCCTGTGGCTGG + Intergenic
1167842145 19:52130970-52130992 AATGAGAATCAACTTGGGGCTGG + Intronic
925536564 2:4924656-4924678 AGTAAAAATCAGCATGGGCCTGG + Intergenic
925836875 2:7954669-7954691 TGAGAAAATCAGCATGAGCCAGG - Intergenic
929756946 2:44774924-44774946 AGGGAAAATCAGCAAGGGGCGGG - Intergenic
929868832 2:45740772-45740794 AGGTAGAATCAGAATGAGGCAGG - Intronic
930649362 2:53949174-53949196 ACTGGAAATCAGCATGATGCAGG - Exonic
931131425 2:59340882-59340904 AGTAAGAAGCAGAATGAGACAGG + Intergenic
931859004 2:66334137-66334159 AGTGAGGATCAGAAAGAAGCGGG - Intergenic
933720513 2:85394727-85394749 AGTGAGAATCAGCCCAGGGCAGG + Exonic
936404459 2:112189764-112189786 ATTGGGAATCATCATGAGGTGGG - Intergenic
936561977 2:113547629-113547651 AGTCAGAAACATCTTGAGGCAGG - Intergenic
942098541 2:172556138-172556160 AGCGGGACTCGGCATGAGGCTGG + Exonic
942648214 2:178137822-178137844 AGCAAAAATCAGCATGAGGCTGG + Intronic
943196270 2:184754441-184754463 AGTGACAAGGAGCATGAGGTAGG - Intronic
946311037 2:218882801-218882823 ACCCAGAATCAGCATGAGGAGGG + Intronic
946823933 2:223657167-223657189 AGTAAGACTCGGCATGAGACAGG - Intergenic
949029452 2:241785077-241785099 AGGGAGAATTATTATGAGGCTGG + Intronic
1172202712 20:33138196-33138218 AGTGGGAATAACCATCAGGCTGG + Intergenic
1173602862 20:44308492-44308514 TGGGAGAAACAGCATGAGTCTGG - Intronic
1173670993 20:44798815-44798837 AGGGAGACGCAGCATGGGGCAGG - Intronic
1175651215 20:60725362-60725384 AGTGAGAATCAGCAACATGGAGG - Intergenic
1177909718 21:27016287-27016309 AGTGAGAATCTTCCTGAAGCTGG + Intergenic
1178532540 21:33387482-33387504 AGTGACCTTCAGCCTGAGGCAGG + Intergenic
1178775332 21:35544774-35544796 AGGGAGGATCAGCAAGAGGCAGG - Intronic
1179631579 21:42681979-42682001 AGTCAGGAGCAGCATCAGGCTGG + Intronic
1179992651 21:44956690-44956712 AAGGAAAATCAGCATGAGACCGG - Intronic
1180957947 22:19749627-19749649 AGAGAGAATCAGCAGGGTGCAGG + Intergenic
1181403423 22:22665597-22665619 AGAGAGAACCAGCAGGAGCCAGG + Intergenic
1181408426 22:22701582-22701604 AGAGAGAACCAGCAGGAGCCAGG + Intergenic
1181413749 22:22745081-22745103 AGAGAGAACCAGCAGGAGCCAGG + Intronic
1181447029 22:22985021-22985043 GGTGTGGAACAGCATGAGGCAGG + Intergenic
1182246334 22:28960768-28960790 AGTAAGAATGAGCAGGAGCCTGG - Intronic
950063118 3:10088984-10089006 AGATAGAATCATCATCAGGCTGG + Intronic
950747797 3:15104565-15104587 AATGAGAAAAAGGATGAGGCTGG + Intergenic
950866477 3:16193702-16193724 AGTGACAACCAGGCTGAGGCTGG - Intronic
951856300 3:27200895-27200917 AGTGGGAAGCACCATGTGGCTGG + Intronic
952749345 3:36812754-36812776 AGTAAGAAGCAGCTAGAGGCAGG + Intergenic
953431984 3:42847615-42847637 AGTGAGACAGAGGATGAGGCAGG + Intronic
953627686 3:44584657-44584679 AGGGAGTCTCAGCCTGAGGCTGG + Intronic
954392775 3:50276109-50276131 AGGGAGAATCCGAAAGAGGCGGG - Intronic
954937106 3:54336462-54336484 AGTGTGAATGAGCATCAGGCCGG + Intronic
955118481 3:56031071-56031093 AGTGAGGATCAGCACTAGGCTGG + Intronic
956234842 3:67058325-67058347 AGTGAAGATTAGCATGAGGGAGG - Intergenic
957803894 3:85121433-85121455 AGTGACAATCACTAAGAGGCAGG + Intronic
960067362 3:113387883-113387905 AGTGAGAATCAGCAATAGCCAGG + Intronic
961306230 3:125960227-125960249 ATTGAGGCTCAGCCTGAGGCGGG + Intergenic
961546012 3:127633862-127633884 AGTGAGAATTAGCAGGTGGGTGG + Intronic
961581970 3:127890781-127890803 AATCAGAATCAGAATGAGTCAGG - Intergenic
963290090 3:143478448-143478470 AGGCAGAGTCAGCAGGAGGCTGG + Intronic
963666991 3:148200488-148200510 CGTGAGATTCTGCAAGAGGCTGG - Intergenic
966306117 3:178536806-178536828 AGTGAGAAGCAGCAAGAGGAGGG + Intronic
967323475 3:188216610-188216632 AGTGAGACTCAGAAAGGGGCAGG - Intronic
968633252 4:1663648-1663670 AGTGAGAAACAGCATTATGTGGG + Intronic
969455481 4:7297523-7297545 AGGGAGACTCAGCAGGGGGCAGG - Intronic
969694050 4:8725003-8725025 GGTGAGCTTCAGCATGAGGAGGG - Intergenic
971147601 4:23995779-23995801 AATGACAATCAGGATGAGGAAGG - Intergenic
971315840 4:25567172-25567194 AGAGAAAACCAGCTTGAGGCCGG - Intergenic
972269077 4:37492394-37492416 AGTGAGAATCACCATCAGTGAGG - Intronic
973280390 4:48354478-48354500 AGCGAGACTCAGCCTGAGGGGGG - Intronic
975752219 4:77535610-77535632 AGTGAGTATCACCAAGAAGCAGG - Intronic
975888241 4:78991811-78991833 AGAGAGCAGCAGCAGGAGGCTGG + Intergenic
975958547 4:79872843-79872865 AGCGAAATTCAGCATAAGGCAGG + Intergenic
978107621 4:104923347-104923369 AGTGAGTATCAGCATGTCACTGG + Intergenic
978379093 4:108107785-108107807 AGTGAGAAGCAGCATGTTGGGGG - Intronic
978986418 4:115019064-115019086 AGTGAGAACAAGAATTAGGCTGG - Intronic
979119382 4:116876473-116876495 AGTGAGAAAGAGAATGAGGGGGG - Intergenic
981455126 4:144944846-144944868 ATGGAGGATCATCATGAGGCAGG - Intergenic
981715431 4:147747205-147747227 AAAGAGAATCAGCATGACTCCGG - Intronic
982897709 4:160954539-160954561 AGAGGGAATAATCATGAGGCAGG + Intergenic
983793331 4:171826562-171826584 AGTCAGATTCAGCCTGAGGTGGG - Intronic
984574375 4:181429897-181429919 AGTTAGAATAAGGAAGAGGCAGG - Intergenic
984932156 4:184857589-184857611 AGTTAGAATGAGCATTAGGCCGG - Intergenic
986566345 5:9118947-9118969 AATGAGAGTAAGCGTGAGGCTGG + Intronic
987063287 5:14262809-14262831 TGTGGGCATGAGCATGAGGCAGG + Intronic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
988893358 5:35644702-35644724 GGTGAGAGTCAGCAAGAGTCAGG - Intronic
990568448 5:57053710-57053732 AGTGAAAACCTGCAAGAGGCTGG + Intergenic
997996402 5:138590243-138590265 AGTGAGAATCAGGAAGATGAAGG + Intergenic
998200981 5:140120640-140120662 AGCCAGAATTAGCATGAGTCAGG + Exonic
998358734 5:141565639-141565661 ACTGAGAATGAGGATGAGGGAGG + Intronic
999088404 5:148913315-148913337 AGGATGAAGCAGCATGAGGCAGG - Intergenic
999902796 5:156104444-156104466 AGTGAGATTCAATATCAGGCAGG - Intronic
1001273672 5:170334555-170334577 AGAGAGAATAAGCAGAAGGCAGG - Intergenic
1002743065 5:181447940-181447962 AGGGAAAATCACCATCAGGCTGG + Intergenic
1002924541 6:1597370-1597392 ACTGAGAATTAACATGAGGATGG - Intergenic
1003824319 6:9935940-9935962 AGTGAGAAGCAGGAGGATGCTGG - Intronic
1004573825 6:16873544-16873566 AGTGAGAAACAGGAGGAGGATGG + Intergenic
1006913446 6:37579073-37579095 ACTGAGTATTAGGATGAGGCAGG - Intergenic
1007226780 6:40320798-40320820 AGGAAGAAGCAGCATGAGTCTGG + Intergenic
1007618487 6:43196803-43196825 ATTGAGAAGCATCATGAGGATGG - Exonic
1008420551 6:51294224-51294246 AGTGAAAATCAGCAGGTGGATGG - Intergenic
1010806820 6:80246805-80246827 AGTGTGTGTCAGCATGGGGCTGG - Intronic
1011330284 6:86197307-86197329 AATGAGAATCACAATGAGGGGGG + Intergenic
1011485328 6:87834873-87834895 GGTGAAAATCAGCATAAGGAAGG + Intergenic
1012612958 6:101238071-101238093 AGTGTAAAACAGCCTGAGGCAGG + Intergenic
1013409769 6:109873444-109873466 AGTGAGAGTGGGCATGGGGCCGG + Intergenic
1013467485 6:110430340-110430362 AGGGAGAATGTACATGAGGCTGG + Intronic
1013902233 6:115171133-115171155 AGGGAAAATCAGCATGAGTCAGG - Intergenic
1016250760 6:142039081-142039103 AGTGTGAAACAGAATGAGTCAGG + Intergenic
1016382068 6:143494547-143494569 ACTGTGAAACAGCATAAGGCAGG + Intergenic
1016753954 6:147663095-147663117 AGTGTGAATTACCATGAAGCTGG + Intronic
1017315954 6:153031622-153031644 AGTGAAAATGAGCCTGAGACAGG - Intronic
1017323561 6:153120488-153120510 ACTGAGAAACAGCAAAAGGCAGG - Intronic
1019048829 6:169167932-169167954 CCTGAGAACCAGCCTGAGGCTGG - Intergenic
1019248164 6:170723353-170723375 AGGGAAAATCACCATCAGGCTGG + Intergenic
1019883054 7:3880388-3880410 AGCGAGAACCAGCACGGGGCGGG + Intronic
1020190027 7:5988450-5988472 AGGGAGAATGAGAATGAGGCAGG + Intronic
1020292895 7:6736225-6736247 AGGGAGAATGAGAATGAGGCAGG - Intergenic
1021312569 7:19111948-19111970 AGTAAGAAGGAGCATGTGGCAGG - Intronic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1023071740 7:36441573-36441595 ACTGAGGAGCAGCAAGAGGCAGG + Intronic
1024414835 7:49094915-49094937 ATTGAGCATCAGCAAGATGCAGG + Intergenic
1024906812 7:54392478-54392500 AGGGAGAATTATTATGAGGCTGG + Intergenic
1027501521 7:78957847-78957869 AGGGAGCAGCAGCATCAGGCTGG - Intronic
1027813045 7:82930298-82930320 AGGGAGAAACAGCATTAGGAGGG + Intronic
1028656999 7:93220033-93220055 TTTGAGAAACAGCAAGAGGCAGG + Intronic
1029029283 7:97451344-97451366 ACTGAGAATGAGCATCAAGCGGG - Intergenic
1029564509 7:101326960-101326982 AGTCAAAAGCATCATGAGGCCGG - Intergenic
1030409500 7:109157665-109157687 GGTGAGAATCAATATGAGGCAGG + Intergenic
1031732538 7:125316364-125316386 AGAGAGAATCTGCTTGAGGGAGG + Intergenic
1031773041 7:125870096-125870118 AGAGAGAGACAGCATGAGGTGGG + Intergenic
1032723271 7:134568236-134568258 TATGAGAATCAACATGAGGTGGG + Exonic
1034236194 7:149571537-149571559 AGTGGTTAGCAGCATGAGGCAGG - Intergenic
1035499936 8:84360-84382 AGGGAAAATCACCATCAGGCTGG - Intergenic
1036344960 8:7955219-7955241 CGTCAGTATCAGCCTGAGGCTGG + Intergenic
1036840298 8:12115986-12116008 CGTCAGTATCAGCCTGAGGCTGG + Intergenic
1036862089 8:12362223-12362245 CGTCAGTATCAGCCTGAGGCTGG + Intergenic
1038353059 8:26798483-26798505 AATGAGAATAAGCAGGAGGTAGG - Intronic
1038581178 8:28750701-28750723 AGTGGGAGTCATCATGAGACAGG - Exonic
1039143059 8:34414965-34414987 AGTAAGAAAAAGCATGAGGATGG + Intergenic
1040485784 8:47869872-47869894 AGTGAAAATCAGCAGTAGCCAGG + Intronic
1040552173 8:48445977-48445999 AAACAGAATGAGCATGAGGCTGG - Intergenic
1043868072 8:85398487-85398509 AGTGAGAGAGGGCATGAGGCAGG + Intronic
1046752592 8:117941048-117941070 TGTGAGAAGCAGGATGGGGCAGG - Intronic
1049890701 9:67698-67720 AGTCAGAAACATCTTGAGGCAGG + Intergenic
1050052636 9:1619186-1619208 ACTGAACAGCAGCATGAGGCAGG + Intergenic
1053116521 9:35509051-35509073 AATCAGAATCAGAATGAGGCTGG + Intronic
1053732168 9:41068884-41068906 AGTCAGAAACATCTTGAGGCAGG + Intergenic
1054696284 9:68362832-68362854 AGTCAGAAACATCTTGAGGCAGG - Intronic
1054817144 9:69486246-69486268 AGTCAGAATTAAAATGAGGCCGG - Intronic
1055693220 9:78856427-78856449 AGTGAGTAAGAGCATGAGGGTGG + Intergenic
1057855290 9:98596640-98596662 AGTGAGAAATAGCAAGGGGCAGG - Intronic
1060265107 9:122107457-122107479 AGTGTGAATCAGCCTGGTGCAGG + Intergenic
1060917960 9:127402605-127402627 CATGAGAAGCAGCATGAGGGAGG - Exonic
1062712221 9:137982238-137982260 AGCCATAATGAGCATGAGGCTGG - Intronic
1203608948 Un_KI270748v1:78975-78997 AGGGAAAATCACCATCAGGCTGG + Intergenic
1186499085 X:10036539-10036561 AGTGAGTAACTGCCTGAGGCTGG - Intronic
1187472843 X:19584793-19584815 GGTGAGAAGCAGCGTGAGCCCGG + Intronic
1187808591 X:23149930-23149952 AATGAGAGTCAGGCTGAGGCGGG + Intergenic
1188628498 X:32318947-32318969 AGTCAGAATCCACATGAGGCAGG - Intronic
1188677845 X:32965074-32965096 AGTGAGAACGAGGATGAGGGAGG + Intronic
1189048687 X:37620609-37620631 AATGAAAATCTGCATGAAGCAGG - Intronic
1189157839 X:38777761-38777783 AGTGAGAAGCAAGATGAGACTGG + Intergenic
1190635365 X:52427403-52427425 AGTGAGACTCACCATAAGGGTGG - Intergenic
1194021675 X:88699060-88699082 TGTGAGTATCAGGATGATGCTGG + Intergenic
1195623405 X:106982492-106982514 AGTGAGAATCAGAATTATCCTGG - Intronic
1196096718 X:111808450-111808472 AGTGAACATCAGCAGTAGGCAGG - Intronic
1197648228 X:129040004-129040026 AGTTAGAATCAGCATAATTCAGG - Intergenic
1200205432 X:154312181-154312203 AGGGAGAATGAGAATAAGGCTGG - Intronic