ID: 1078541636

View in Genome Browser
Species Human (GRCh38)
Location 11:12217896-12217918
Sequence GAGCTATAGCCTGAGCGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078541633_1078541636 5 Left 1078541633 11:12217868-12217890 CCACAGGCTGGACACCTGATTGG 0: 1
1: 0
2: 1
3: 12
4: 131
Right 1078541636 11:12217896-12217918 GAGCTATAGCCTGAGCGTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 67
1078541635_1078541636 -9 Left 1078541635 11:12217882-12217904 CCTGATTGGAACAAGAGCTATAG 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1078541636 11:12217896-12217918 GAGCTATAGCCTGAGCGTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078541636 Original CRISPR GAGCTATAGCCTGAGCGTCC AGG Intronic
900409085 1:2504790-2504812 GAGCCACAGCCTGGGCCTCCCGG + Exonic
906101853 1:43268977-43268999 GAAATATAGCCTGAGCCGCCGGG - Intronic
912581401 1:110724220-110724242 GAGCTATACCATGAGCCTCAGGG - Intergenic
917755423 1:178093879-178093901 GAGCTGTGGCCTGAGAGTCAGGG + Intergenic
920611673 1:207445373-207445395 GAGCTATTGTCTGAACCTCCTGG - Intergenic
921011715 1:211148332-211148354 CAGCTATAGCCAGAGAGTCCAGG + Intergenic
924119687 1:240783736-240783758 TAGCTATAGCCTGAGAGCCTGGG + Intronic
1062892112 10:1071007-1071029 CAGCAATAGCCTGAGCCTCAAGG - Intronic
1064212972 10:13376260-13376282 GAGCTACAGGCAGAGCATCCAGG - Intergenic
1072607306 10:96995400-96995422 GAGCTACAGACTGATCTTCCGGG - Intergenic
1072957655 10:99901602-99901624 GAGCTGTGGCCTGAACGTGCGGG + Intronic
1074188652 10:111117124-111117146 CAGCTTTAGCCTGAACGTTCTGG - Intergenic
1074991082 10:118708713-118708735 GAGCGAGAACCTGAGCGTTCTGG - Intronic
1078541636 11:12217896-12217918 GAGCTATAGCCTGAGCGTCCAGG + Intronic
1079850528 11:25527954-25527976 GAGCCATAGCCTGAGGGTACAGG - Intergenic
1084121313 11:67070640-67070662 GACCTACACCCTGAGCGTTCTGG - Intronic
1085054309 11:73394967-73394989 GAGCCTTAGCCTGAGAGGCCCGG - Intronic
1087917205 11:103824761-103824783 AAGCTCTACCCTGAGAGTCCAGG + Intergenic
1090866481 11:130705215-130705237 GATCTATAGCTTGAGCCACCTGG - Intronic
1097354360 12:58584973-58584995 GTGCTATAGACTGTGCGTGCAGG - Intronic
1097909173 12:64950688-64950710 GAGCTATAGCCACAGCATCTGGG + Intergenic
1101794971 12:107964553-107964575 GATGTATAGCCTGAGAGCCCTGG - Intergenic
1103735122 12:123056277-123056299 GAGCTATCACCTGAGCGCTCTGG + Intronic
1106626643 13:31427357-31427379 GAGCTCTAGCTTGGGCTTCCTGG + Intergenic
1130916714 15:88310818-88310840 GAGCTCTAGCCTGACCTTCAAGG + Intergenic
1132500478 16:282640-282662 CAGCTATGGCCCGAGCGCCCAGG + Exonic
1133985610 16:10665859-10665881 GAGCTATAGCCTGAGATAGCTGG + Intronic
1135160438 16:20090504-20090526 CAGCTATAACCTGAGGGTGCTGG - Intergenic
1142592109 17:1010790-1010812 GAAGTACAGCTTGAGCGTCCCGG + Exonic
1146842191 17:36163864-36163886 GAAGTATAGGCTGAGCTTCCTGG - Intergenic
1146854500 17:36251823-36251845 GAAGTATAGGCTGAGCTTCCCGG - Intronic
1146866119 17:36336553-36336575 GAAGTATAGGCTGAGCTTCCTGG + Intronic
1146870402 17:36375715-36375737 GAAGTATAGGCTGAGCTTCCCGG - Intronic
1146877758 17:36426796-36426818 GAAGTATAGGCTGAGCTTCCTGG - Intronic
1147068988 17:37937165-37937187 GAAGTATAGGCTGAGCTTCCCGG + Intergenic
1147073284 17:37976339-37976361 GAAGTATAGGCTGAGCTTCCCGG - Intergenic
1147080513 17:38016702-38016724 GAAGTATAGGCTGAGCTTCCCGG + Intronic
1147084805 17:38055877-38055899 GAAGTATAGGCTGAGCTTCCCGG - Intronic
1147096459 17:38140662-38140684 GAAGTATAGGCTGAGCTTCCCGG + Intergenic
1147100753 17:38179843-38179865 GAAGTATAGGCTGAGCTTCCCGG - Intergenic
1163738324 19:18995390-18995412 GAGCTTGAGCCTGAGCATCTGGG - Intronic
1165325737 19:35113481-35113503 CAGGTAGAGCCTGAGCGGCCAGG - Intergenic
938142834 2:128810985-128811007 GTGTTAGAGCCTGAGGGTCCGGG + Intergenic
954603823 3:51893542-51893564 GAGCTAGAGCCTGAGACTTCTGG + Intergenic
965831631 3:172796699-172796721 GCACTATAGCCTGGGCGACCGGG - Intronic
974997559 4:69179969-69179991 AAGCTGTAGCCTGAGCGCCATGG - Intronic
983062018 4:163171721-163171743 GTTTTACAGCCTGAGCGTCCAGG - Intergenic
984057612 4:174949079-174949101 GAGCTATAACGTGAGCCCCCAGG + Intronic
986345797 5:6833983-6834005 GAGCTACAGCCTGACTGGCCAGG + Intergenic
988974600 5:36502419-36502441 GACCTGTAGCCTGGGCTTCCTGG + Intergenic
998182979 5:139958262-139958284 GAGCTATAGCTTGAGACTCTGGG + Intronic
999394793 5:151220684-151220706 GAGCTATAGCCACAGCCTTCGGG + Intronic
1003491496 6:6626491-6626513 GAGCTCTGGTCTGGGCGTCCTGG - Intronic
1008546145 6:52585381-52585403 GAGCTCCAGCCTGAGCGACAGGG + Intergenic
1016927070 6:149361422-149361444 GAGCCATAGCTGGAGCGGCCTGG + Intronic
1017655727 6:156627415-156627437 GAAGTATAGCCTCACCGTCCTGG + Intergenic
1023318817 7:38971287-38971309 CAGCTGGAGCCTGAGCGTGCAGG - Intergenic
1027834155 7:83219328-83219350 GAACTGTTGCCTGAGCATCCAGG - Intergenic
1032328349 7:130953214-130953236 GAGATCTAGCCTGAGCCTGCAGG - Intergenic
1035068335 7:156123708-156123730 CAGCTATGGCCTGAGTGTCTGGG + Intergenic
1039424970 8:37478081-37478103 CAGCTAGAGCTTGAGCATCCTGG - Intergenic
1040092343 8:43410783-43410805 GTGCTACAGCCTGAGTGGCCAGG - Intergenic
1045351056 8:101340000-101340022 GAGCTATAGCCTCAAACTCCTGG + Intergenic
1059308710 9:113374069-113374091 GGGCTACAGCCTGAGCATCCTGG + Exonic
1061282633 9:129606242-129606264 GGGCCATAGCCAGTGCGTCCAGG - Intergenic
1061301859 9:129710072-129710094 GAGCTTAAGCCTGTGGGTCCAGG + Intronic
1186491114 X:9973171-9973193 GAGCTCTAGCCTGGGCGACAGGG - Intergenic
1186758052 X:12693982-12694004 TAGCTATAGCCTGATCCTGCAGG - Intronic
1196036371 X:111149488-111149510 AAGCTTTTGCCTGAGCATCCAGG + Intronic
1199866076 X:151851439-151851461 GAGCTCCAGTCTGAGCCTCCAGG + Intergenic
1201397677 Y:13566434-13566456 GAGCTATAGCTGGAGATTCCTGG - Intergenic