ID: 1078543610

View in Genome Browser
Species Human (GRCh38)
Location 11:12230418-12230440
Sequence CCTTCTGGAGTGGAGATACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078543602_1078543610 1 Left 1078543602 11:12230394-12230416 CCCTCAATGACCTTGCTCATCAG 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1078543610 11:12230418-12230440 CCTTCTGGAGTGGAGATACAGGG 0: 1
1: 0
2: 2
3: 12
4: 134
1078543603_1078543610 0 Left 1078543603 11:12230395-12230417 CCTCAATGACCTTGCTCATCAGC 0: 1
1: 0
2: 2
3: 7
4: 134
Right 1078543610 11:12230418-12230440 CCTTCTGGAGTGGAGATACAGGG 0: 1
1: 0
2: 2
3: 12
4: 134
1078543601_1078543610 30 Left 1078543601 11:12230365-12230387 CCAAGATATCAGTACAACAAAAC 0: 1
1: 0
2: 1
3: 15
4: 166
Right 1078543610 11:12230418-12230440 CCTTCTGGAGTGGAGATACAGGG 0: 1
1: 0
2: 2
3: 12
4: 134
1078543605_1078543610 -9 Left 1078543605 11:12230404-12230426 CCTTGCTCATCAGCCCTTCTGGA 0: 1
1: 0
2: 3
3: 20
4: 200
Right 1078543610 11:12230418-12230440 CCTTCTGGAGTGGAGATACAGGG 0: 1
1: 0
2: 2
3: 12
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078543610 Original CRISPR CCTTCTGGAGTGGAGATACA GGG Intronic
900852521 1:5155192-5155214 CCTTCTTTATTGGAAATACATGG + Intergenic
906515715 1:46437717-46437739 CCTTCGGTGGTGGAGATTCAGGG + Intergenic
907810417 1:57864214-57864236 CCTTCTGGAGAAGAAACACAAGG + Intronic
910171741 1:84385498-84385520 CCTTCAGGAGTGCAGAGCCAAGG + Intronic
910919523 1:92329021-92329043 CCTGCTCCAGTGGAGGTACAGGG + Intronic
911751866 1:101504747-101504769 CCTTCAGGAGAGGACATAGACGG + Intergenic
915698660 1:157769942-157769964 CCGTGTGGAGTGAAGACACAGGG - Exonic
915940909 1:160117681-160117703 GCCTCTGCAGTGGAGATGCAGGG - Intronic
919034227 1:192284945-192284967 CTTTCTGGAGGGCAGATGCAGGG + Intergenic
922198382 1:223380253-223380275 ACTTCTGGATTGGAGATGTAGGG - Intergenic
1063376032 10:5554973-5554995 CCTGCTGAAGTGGAGAGAAAAGG + Intergenic
1069616942 10:69812230-69812252 GCTTCTGGAGTCCAGCTACATGG + Intronic
1073204232 10:101760223-101760245 CCTGCTGCAGTTGAGATACCAGG + Intergenic
1074507013 10:114080009-114080031 CCATCTGGAGTGCAGAAACAGGG - Intergenic
1075237678 10:120745792-120745814 TACTCTGGATTGGAGATACAGGG + Intergenic
1076024750 10:127102104-127102126 CGTTCTGGAGTGGAGATTTATGG + Intronic
1076066729 10:127454209-127454231 CCTTCTGGAATGTGGATCCAGGG + Intergenic
1076231349 10:128822396-128822418 CCTTCTGGTGTGGAGCAACATGG - Intergenic
1076779532 10:132716590-132716612 CCAGCGGGAGTGGAGACACACGG - Intronic
1077941525 11:6848531-6848553 CCTTCTGGAGTGGTGGCCCAAGG - Intergenic
1078099030 11:8318747-8318769 CCCTGTGGAGTGGACACACAAGG - Intergenic
1078489898 11:11759078-11759100 CCCTCTGGTGTGTAGAGACAAGG - Intergenic
1078543610 11:12230418-12230440 CCTTCTGGAGTGGAGATACAGGG + Intronic
1079478274 11:20854456-20854478 ACTTCTGTAGTGGACCTACAGGG + Intronic
1081070412 11:38603587-38603609 CCTTCAGGACAGGAGATAGATGG + Intergenic
1081919488 11:46759715-46759737 CCTTCAGGAATAGAAATACAAGG - Intronic
1084027330 11:66459516-66459538 CCTTCTGGAGTGTGGGTGCAGGG + Intronic
1084456603 11:69271351-69271373 CAGACTGGAGTGGAAATACATGG - Intergenic
1088291944 11:108248526-108248548 CTTTCTGAAATGAAGATACAGGG - Intronic
1088796888 11:113272581-113272603 CCTCCTTGAATGGAGATCCAGGG + Intronic
1090178206 11:124670812-124670834 CCTACTGGGCTGGAGATGCACGG + Intronic
1090213200 11:124937632-124937654 CCTTCTGGAGTGTAGATAAATGG + Intergenic
1092469677 12:8766688-8766710 CCTTCAGGACAGGAGATAGAGGG - Intronic
1093719334 12:22420463-22420485 CCCTCAAGAGTGGAGATATATGG - Intronic
1093719833 12:22427103-22427125 CCCTCAAGAGTGGAGATATATGG - Intronic
1093821037 12:23617900-23617922 GCTTATGGAGTAGAAATACAGGG - Intronic
1096799002 12:54096971-54096993 CAGTCTGGAGTGGAGGTAGAGGG + Intergenic
1097920667 12:65069024-65069046 CCTACTCCAGTGGAGATACAAGG - Intronic
1099567482 12:84270969-84270991 CCTTCTAGACTTGAGATAGAAGG - Intergenic
1100287793 12:93183885-93183907 GCATCTGGAGTGGAGATACCTGG - Intergenic
1101229356 12:102724168-102724190 CCTTATGGCTTGGAGACACATGG - Intergenic
1102536055 12:113582486-113582508 CCATCTGCAGAGGAGAAACACGG - Intergenic
1108699339 13:52930502-52930524 CCTTCTGGGGTGGAGGTGGAGGG + Intergenic
1112310739 13:98315510-98315532 CCTTTAGGAGTGGAGACAAACGG - Intronic
1112986850 13:105460779-105460801 CCTTCTGGAATTGAGATTTATGG - Intergenic
1114716115 14:24826767-24826789 CCTTCCTGATTAGAGATACAAGG + Intronic
1115418453 14:33164874-33164896 CCTTCTGTACTGGTGAGACAGGG + Intronic
1116668977 14:47817089-47817111 CCTTCTGCAGTGGAGGTAGCAGG + Intergenic
1118513978 14:66507470-66507492 GCAGCTGGAGTGGAGATACCTGG - Exonic
1118818217 14:69327563-69327585 ACTTTTGGAGTGGAGATTGATGG + Intronic
1120722755 14:87905946-87905968 GCTTCTGGAGTGTAGAGGCAGGG - Intronic
1122838960 14:104445327-104445349 TCTGCTGGATTGGAGATGCAAGG + Intergenic
1123662445 15:22576096-22576118 CCTACTGCATTGGAGAAACAGGG - Intergenic
1124316245 15:28670380-28670402 CCTACTGCATTGGAGAAACAGGG - Intergenic
1125897289 15:43313319-43313341 CCTGATGGAGTTGAGACACAGGG - Intergenic
1126564090 15:50076539-50076561 CCTTGTGGAGTGTGGTTACATGG - Intronic
1131453326 15:92563911-92563933 CCCTCAGGAGCTGAGATACAAGG + Intergenic
1133699239 16:8293798-8293820 CCTTCTGTCATGGAGATAGAGGG + Intergenic
1137031331 16:35526978-35527000 GCTTCTGGAGGCGAGATAAATGG - Intergenic
1137362189 16:47828877-47828899 GGTTCTGGAGTTAAGATACAAGG - Intergenic
1137633557 16:49965973-49965995 CCTTTTGTAGTGGAGAGGCATGG - Intergenic
1138073236 16:54014707-54014729 CCTTCTGCAGTGGAGTTAGGAGG - Intronic
1140421601 16:74823824-74823846 ACTTCTGGAGTGGAGGTAGGAGG + Intergenic
1144404913 17:14942853-14942875 CTTTCTGGAGTTTTGATACAGGG + Intergenic
1148568004 17:48645162-48645184 CCTTCTGGACTGGAGAAATGGGG + Intergenic
1149285535 17:55159919-55159941 CCTTAGGAAGTGGAGCTACATGG + Exonic
1151258623 17:72899268-72899290 CTTGCTGGGGTGGAAATACAGGG + Intronic
1154092637 18:11379356-11379378 CATTCTGGGCTGGAGAAACAAGG - Intergenic
1157184251 18:45524581-45524603 CCTTCTGATGTGGATATATAGGG - Intronic
1168429125 19:56263424-56263446 CCTTCTGGCTTGGAGATGAAAGG - Intronic
1168586213 19:57594824-57594846 CCTTCTGGAGGGCAGATACAGGG + Intergenic
925199982 2:1959394-1959416 CCTCCTGGAGAGTAGAGACAGGG + Intronic
925949394 2:8896832-8896854 CCTTCAGGACAGGAGATAGATGG - Intronic
926883525 2:17575170-17575192 CCTTCTGGATTGCAGGTACTGGG + Intronic
932290037 2:70569370-70569392 CCTTCTGAACTTGAGATCCAGGG + Intergenic
935225289 2:101047308-101047330 CCTGCTGGAGTGGCCACACATGG + Intronic
940469200 2:154072255-154072277 CCTTCTGGACTAGTGCTACATGG + Intronic
944160522 2:196654707-196654729 CCTACTGAAATGGAGATATATGG - Intronic
944468608 2:200029485-200029507 CCTGGTGGAGTGGACAGACATGG + Intergenic
945517380 2:210779181-210779203 GCTTCTGGAGTAGAGTTGCAAGG + Intergenic
948236149 2:236392343-236392365 CCTTCTGGAGTGTAGAAATCTGG - Exonic
948644701 2:239397228-239397250 CCTTTGGGACTGGAGATGCAGGG + Intronic
1168840794 20:908881-908903 GCCTCTGGAGAGGAGAAACAGGG + Intronic
1171797423 20:29577378-29577400 CAGTCTGGAGTGGAGGTAGAGGG - Intergenic
1171850828 20:30306783-30306805 CAGTCTGGAGTGGAGGTAGAGGG + Intergenic
1173870490 20:46338969-46338991 ACTCCTGGAGTGGAGATGGATGG + Intergenic
1175977496 20:62718482-62718504 TCTTCTGAAGTGGGGATACATGG - Intronic
949505591 3:4724665-4724687 CCTTTTGGAGGGCAGATTCACGG + Intronic
953796796 3:45992181-45992203 CTTTCAGGAATGGAGAGACAAGG - Intronic
954443967 3:50536658-50536680 CCTAGTGGAGAGGAGAGACAGGG - Intergenic
958630028 3:96672543-96672565 CCTTCAGGACAGGAGATAGATGG - Intergenic
962166784 3:133057970-133057992 CCTTCTGAAGGAGAGATACCAGG + Intronic
962258466 3:133887725-133887747 CCTTCTGGCTTGGAGATACCAGG - Intronic
969430646 4:7151964-7151986 ACTGCTGGAGTGGAGTTACGCGG - Intergenic
970098126 4:12487911-12487933 GCTTCTGGAGGGCACATACAAGG - Intergenic
971134507 4:23853674-23853696 CCTTCTGGGTAGGAGATATAAGG - Intronic
972336321 4:38109949-38109971 TCTTCTGCAGAGGAGATAGAGGG + Intronic
973635194 4:52855707-52855729 CCTTCTGTTGTGGGGATGCACGG + Intergenic
982332251 4:154193475-154193497 CCTGATGTAGTGGAGAAACATGG + Intergenic
984737062 4:183119227-183119249 CCTTCTGGAGAGGGAATTCATGG - Intronic
986240559 5:5956033-5956055 CATTCTGGAAAGGAAATACATGG + Intergenic
988582949 5:32484353-32484375 TTTTCTGAAGTGGATATACAGGG - Intergenic
995364078 5:111335043-111335065 CCAGCTGGAGCGGAGAAACATGG + Intronic
997608721 5:135195277-135195299 CCTTCTACAGTGGATATACTTGG - Intronic
997887246 5:137641198-137641220 CTTTCTTGAGTGGAGAGAAAGGG + Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
999684261 5:154088425-154088447 CCTTCTGGTGTGGAGAAGGAGGG - Intronic
1002295961 5:178231668-178231690 ACCTGTGGAGTGGAGAGACAAGG - Intronic
1005835976 6:29709940-29709962 CCCTGTGCAGGGGAGATACAAGG + Intergenic
1009475715 6:64089251-64089273 TCTTCAGGAAAGGAGATACATGG - Intronic
1010365832 6:75050131-75050153 CCTTCTGGATTGAAGATCTAAGG - Intergenic
1011156577 6:84340517-84340539 CCTGCTGCAGTGGAGATACCAGG + Intergenic
1011492786 6:87909975-87909997 CCTTCTGAATTGGAGAGCCAAGG - Intergenic
1015690999 6:135922554-135922576 CATATTGGAGAGGAGATACATGG + Intronic
1015758309 6:136630581-136630603 CCTCCTGGAGAGGAAATAAATGG - Intronic
1017055157 6:150430053-150430075 CCTCCAGGGGTGGAGATGCAAGG - Intergenic
1017848417 6:158280644-158280666 CCTTATGGAGTGGTGATAGTTGG + Intronic
1018542881 6:164902109-164902131 CCATTTGGAGTGGAGCTGCAGGG - Intergenic
1019548571 7:1590929-1590951 CCCTCAGGAGTGGAGAGACTTGG + Intergenic
1024246216 7:47472289-47472311 CCATCTGTAGGGGAGGTACAGGG - Intronic
1027631131 7:80607707-80607729 CCTACTGGCATGGAGATACATGG - Intronic
1028016530 7:85720957-85720979 AATTTTGGAGTGGAGATAAAGGG + Intergenic
1030229384 7:107190879-107190901 CCTTCTGGAGTCAGGACACATGG - Intronic
1031471269 7:122172097-122172119 CCTTCGGGACAGGAGATAGATGG + Intergenic
1034069999 7:148175424-148175446 CTTTCTGGAATGGAGAAGCATGG + Intronic
1035651984 8:1273408-1273430 GCTTATGGAGTGGAGACCCAGGG + Intergenic
1037416684 8:18658895-18658917 TCTTGTGTAGTGGAGAAACAAGG - Intronic
1037709104 8:21341603-21341625 TCTTCTGGAGTGCAGCCACAGGG + Intergenic
1037913273 8:22756980-22757002 CCTTCTGCAGTGGGGATAGCTGG - Intronic
1041519892 8:58744153-58744175 CCTTGTGGAGAGGTGAAACACGG + Intergenic
1045775927 8:105802387-105802409 GGTTCTTGAGTGGAGGTACAAGG - Exonic
1048735119 8:137490666-137490688 CTTTCTGGAGTGTAGATAAAAGG - Intergenic
1048892020 8:138956614-138956636 CCTTATGGAAAGGAGAAACATGG + Intergenic
1049262175 8:141645711-141645733 CCCTCTGGAGTGGGGACACAGGG - Intergenic
1050225185 9:3446063-3446085 GCTTGGGCAGTGGAGATACAGGG - Intronic
1050689625 9:8210770-8210792 ACCTCTGGAGTGGAGAGAAAAGG - Intergenic
1052458024 9:28726316-28726338 CCTGCTGAAGTGGGGCTACAAGG + Intergenic
1053788607 9:41670075-41670097 CAGTCTGGAGTGGAGGTAGAGGG + Intergenic
1054156531 9:61644693-61644715 CAGTCTGGAGTGGAGGTAGAGGG - Intergenic
1054176892 9:61881414-61881436 CAGTCTGGAGTGGAGGTAGAGGG + Intergenic
1054476302 9:65575702-65575724 CAGTCTGGAGTGGAGGTAGAGGG - Intergenic
1054660643 9:67699392-67699414 CAGTCTGGAGTGGAGGTAGAGGG - Intergenic
1056107976 9:83366141-83366163 CATTCTGGGGTGGAGAGAAAGGG + Intronic
1189034405 X:37480750-37480772 CCTTCAGGACAGGAGATAGATGG + Intronic
1190969327 X:55333558-55333580 CTGTTTGGAGTGGAGATACCAGG - Intergenic
1192312458 X:70028045-70028067 CCTGGTGGGGTGGAGAGACAGGG - Intronic
1193063534 X:77232995-77233017 CCTTCTCAAGTGGAAAGACAGGG - Intergenic
1195910789 X:109886795-109886817 CCTTCTGGGAAGGAGAAACAGGG + Intergenic
1197331500 X:125158494-125158516 CATTCTGGAGCAGAGATACAGGG + Intergenic