ID: 1078544500

View in Genome Browser
Species Human (GRCh38)
Location 11:12237161-12237183
Sequence ATTCAACCCATTATCTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078544497_1078544500 1 Left 1078544497 11:12237137-12237159 CCTTGGGGAAAGCAGCAGCCAGC 0: 1
1: 0
2: 12
3: 35
4: 317
Right 1078544500 11:12237161-12237183 ATTCAACCCATTATCTGTGATGG 0: 1
1: 0
2: 0
3: 9
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078544500 Original CRISPR ATTCAACCCATTATCTGTGA TGG Intronic
904095846 1:27976659-27976681 GTTCAACCTATACTCTGTGAAGG - Intronic
909470855 1:76026473-76026495 TTTCAACTCCTTAGCTGTGAAGG + Intergenic
909821246 1:80064535-80064557 ATTGAAGTCATTACCTGTGACGG - Intergenic
911853506 1:102849021-102849043 CTTTATCCCTTTATCTGTGATGG - Intergenic
913298238 1:117343209-117343231 CTTCATCCTCTTATCTGTGAGGG + Intergenic
914381938 1:147124300-147124322 CTTCAACCCATTATGTGTTTGGG - Intergenic
916840780 1:168598278-168598300 GTTCTACCCATTCTTTGTGAAGG - Intergenic
917183900 1:172330237-172330259 ATTCAACCAATTTTCTATGATGG - Intronic
917643986 1:177011452-177011474 ATTCACCCCATTACCTATTATGG - Intronic
919597015 1:199576880-199576902 ATTTAACCAATGATCTGTGAAGG + Intergenic
920877344 1:209849243-209849265 ACTCCACCTTTTATCTGTGAGGG + Intronic
921115866 1:212090789-212090811 ATTCAATCAATTATTTGTTAAGG - Intronic
921190598 1:212704633-212704655 ATTTAAACCATAAACTGTGAAGG + Intergenic
1063301764 10:4855184-4855206 ATTCAACCCATTTGCAGGGATGG - Intergenic
1063563182 10:7148223-7148245 GCTCAACCCATTCTCTGAGAGGG - Intergenic
1063763370 10:9107880-9107902 ATTCACCCCTTTCTCTATGAGGG - Intergenic
1066114582 10:32228220-32228242 ATTTAACCCATTTTCCGTTAAGG + Intergenic
1068029342 10:51687907-51687929 GTTCACTCAATTATCTGTGAAGG + Intronic
1074543672 10:114386184-114386206 CTTCAACGGAATATCTGTGAGGG + Intronic
1077734333 11:4773106-4773128 TTTCACCCAAATATCTGTGACGG + Intronic
1078544500 11:12237161-12237183 ATTCAACCCATTATCTGTGATGG + Intronic
1079012912 11:16844414-16844436 ATTCAATGGATTAACTGTGAAGG + Intronic
1079277776 11:19057706-19057728 ATTCACCCCATTATGAGTAAGGG - Intronic
1082214799 11:49556465-49556487 ATTCAACAGGTTCTCTGTGAAGG + Intergenic
1086700129 11:89892373-89892395 ATTCAAGTCATTCTCTATGAAGG - Intergenic
1086706041 11:89952143-89952165 ATTCAAGTCATTCTCTATGAAGG + Intergenic
1086809521 11:91290375-91290397 ATTCAATCCATCATTTGTGTTGG - Intergenic
1087919769 11:103853194-103853216 ATACAACTCATAATGTGTGATGG + Intergenic
1090086889 11:123658000-123658022 GTTTCACCCATTAACTGTGAAGG - Intergenic
1090242638 11:125194755-125194777 ATTCAACGCATTTTTAGTGATGG + Intronic
1090657200 11:128855254-128855276 ATTGTACCCATTTTCAGTGATGG + Intronic
1090848865 11:130553382-130553404 ATTCTCCCCATTTTCTGTCAAGG - Intergenic
1091688465 12:2580041-2580063 GTACAACCCAGTATGTGTGATGG - Intronic
1096190244 12:49612643-49612665 ATTGAATCCTTTATCTGAGAGGG - Intronic
1098499626 12:71176295-71176317 ATTTAACTCATTATTAGTGAGGG + Intronic
1099764651 12:86968114-86968136 ATACAACATATTTTCTGTGAGGG - Intergenic
1100438917 12:94597470-94597492 ACTCAATCCATTATTTGTGATGG + Intronic
1102200464 12:111054433-111054455 ATTCTGCCCATTATCTGGAATGG - Intronic
1102767565 12:115446871-115446893 GTTCACCCCATTATCTTTGTAGG + Intergenic
1107442630 13:40441630-40441652 GGTGAAGCCATTATCTGTGATGG - Intergenic
1108783793 13:53869604-53869626 ATTCATCCCATTCTCTTGGAAGG + Intergenic
1110603517 13:77403824-77403846 ACTCAACCCACTGCCTGTGAAGG - Intergenic
1111042774 13:82771369-82771391 ATTCAACAGATAATCTGTGGAGG - Intergenic
1112554854 13:100457557-100457579 ATGCAACCCATTATGTGTGCAGG - Intronic
1116575104 14:46564187-46564209 TTTCTACCCATTTTCTGTGGTGG - Intergenic
1117983737 14:61367201-61367223 ACTCTACCCTTTCTCTGTGATGG - Intronic
1123986153 15:25647905-25647927 AGTCAACCCATCCTTTGTGAGGG - Intergenic
1124439742 15:29677408-29677430 AATCAACACATTACCTATGAAGG - Intergenic
1127243821 15:57149635-57149657 ATCAAACCCATTATCTATTATGG + Intronic
1137628092 16:49922082-49922104 CTTCACCCCATTACCTGTGCTGG - Intergenic
1140192895 16:72833329-72833351 ATGCAATCCATGATCTGTGGGGG - Intronic
1143591623 17:7888591-7888613 CCCCACCCCATTATCTGTGAAGG - Intronic
1146070524 17:29676827-29676849 ATTCAAACCTGTATCTGTGCAGG - Exonic
1146668353 17:34719887-34719909 ATACAACCCATCATCGGTGGAGG + Intergenic
1150099591 17:62410842-62410864 ATTGAAACCAGTATCTGTAAGGG + Intronic
1150182116 17:63133839-63133861 ATTCTACCCATTCTATGTGTAGG - Intronic
1156682678 18:39609915-39609937 ATGCAACCCACTATGTGTGCAGG + Intergenic
1157072748 18:44428679-44428701 ATTTAAACCAATTTCTGTGAAGG + Intergenic
1157854222 18:51090174-51090196 ATTCAACCATTCACCTGTGAAGG - Intergenic
1159209461 18:65298066-65298088 ATGCAACCCATGATGTGTGCAGG + Intergenic
1164463169 19:28465527-28465549 ATTCAACCCATGAGCAGTGGAGG - Intergenic
925674258 2:6343562-6343584 CTTCATGCCTTTATCTGTGAAGG - Intergenic
931972293 2:67602057-67602079 TTTCAACCCATTTTCTCAGAGGG - Intergenic
932227030 2:70049833-70049855 ATTAAATCCATTCTCTGAGATGG + Intergenic
935920337 2:108006040-108006062 ATTCCACCCAGCATCTGTGCGGG - Exonic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
941410504 2:165150756-165150778 AATAAACTCATTATCTGTGTAGG + Intronic
947404276 2:229758139-229758161 GTTCATCCCATCATCAGTGAGGG + Intergenic
948014897 2:234680421-234680443 ATTCAACCAATTTTCTGTAATGG - Intergenic
948731499 2:239966672-239966694 ATTCACCCTCTTAACTGTGAGGG - Intronic
1171105262 20:22427299-22427321 ATACAACAAATTATCTGGGATGG - Intergenic
1179269771 21:39841581-39841603 ATTCACCCCATTCTCTGGGGTGG + Intergenic
1180570706 22:16716054-16716076 ATTAAACCCATTATTTATCAAGG - Intergenic
949499415 3:4664971-4664993 ATTCAGCCCATCAACTGAGATGG - Intronic
949989119 3:9562850-9562872 ATTCAAACCATTATTTGAAAGGG - Intergenic
952077507 3:29714983-29715005 ATTAAAACTATTATCTATGAGGG - Intronic
955969413 3:64422558-64422580 ATTTATGCCATTATCTGTCAAGG - Intronic
958717900 3:97809321-97809343 ATCCAAGTTATTATCTGTGATGG + Intergenic
959372887 3:105551155-105551177 ATTCCAGTCATAATCTGTGAGGG - Intronic
959791738 3:110369589-110369611 ATTCAACCCATTGCATGTGCAGG - Intergenic
960408937 3:117297729-117297751 CTTCAATCCATTCTCTGTAAAGG - Intergenic
961624489 3:128252211-128252233 ATTCAACCCATTCACAGGGAGGG - Intronic
967440471 3:189501909-189501931 AGGCAACCCATTATCTTTTAAGG + Intergenic
969659923 4:8520736-8520758 ATTCAACGACTTAGCTGTGATGG + Intergenic
979102473 4:116637531-116637553 ATTCAAGACAATATCTTTGAAGG - Intergenic
982578756 4:157151809-157151831 ACTCAACCCAGTATGTGAGATGG + Intronic
985545443 5:506693-506715 AGTCAACCCACTCTCTCTGAAGG - Intronic
986024129 5:3834287-3834309 AGTCAACTCATCATCTGTAAAGG + Intergenic
989155402 5:38340122-38340144 ATTCAGCCCAGGTTCTGTGATGG - Intronic
999038809 5:148384186-148384208 ATTCAACCCCTGATCTCTCAAGG - Intronic
1000686997 5:164262554-164262576 ATTCAACACATTATATGAAAAGG - Intergenic
1001157158 5:169282608-169282630 ATTTATCCCATTATAGGTGAAGG - Intronic
1005124399 6:22429844-22429866 ATTCAGCCCACTATCTCTCATGG - Intergenic
1005143095 6:22656596-22656618 ATTCAAACCATTATTTTTAAGGG - Intergenic
1005773674 6:29104894-29104916 ATTTATCCATTTATCTGTGAAGG + Intergenic
1009640225 6:66325886-66325908 ATTCAAAACATGCTCTGTGAAGG + Intergenic
1009788546 6:68369629-68369651 ATACAACCCATTCTCTGGGAAGG - Intergenic
1010205307 6:73317200-73317222 ATTTAACTCATTTTCTATGATGG - Intergenic
1011003280 6:82615472-82615494 ATACAACCCATTTTCTTTGCAGG - Intergenic
1011891679 6:92170577-92170599 ATTCAATCCATAATGTTTGATGG + Intergenic
1013456267 6:110332304-110332326 ATTCACCACATTTTCTGTGTAGG + Intronic
1014281641 6:119448168-119448190 ATTCAACCCATAGGCTGTTATGG + Intergenic
1015135648 6:129866829-129866851 ATTCAACACATTAACTTTCAGGG + Intergenic
1015710569 6:136134698-136134720 ATTCAACCCATTCGTTGGGATGG + Intronic
1020916346 7:14198510-14198532 ATGCAGCCCATTATGTGTGCAGG - Intronic
1021970963 7:25965649-25965671 ATCCATCCCAGTGTCTGTGAAGG + Intergenic
1023298260 7:38739559-38739581 TTTAAACTCTTTATCTGTGAGGG + Intronic
1023728194 7:43165486-43165508 ATTCAATCAATTATCCGTGAAGG + Intronic
1024361929 7:48477172-48477194 ATTCTAACCATTATCCGTGTAGG - Intronic
1026668824 7:72368784-72368806 TTTCAAACCATTCTCTGTGATGG - Intronic
1026929988 7:74218427-74218449 ATCCACTCCATTATCTGTAATGG + Intronic
1027914516 7:84298694-84298716 TTTCTACATATTATCTGTGATGG + Intronic
1028080934 7:86574978-86575000 ATTCAATTTATTCTCTGTGAAGG + Intergenic
1036113793 8:5935565-5935587 ATTCAAATTATTATCTGAGAAGG - Intergenic
1038999503 8:32963924-32963946 ATTCAACCCAGTCTTTGTGGGGG - Intergenic
1041268630 8:56089222-56089244 ATCCATCTCATTATCTCTGAAGG + Intergenic
1042022808 8:64387889-64387911 ATTCATTTCATTAGCTGTGAAGG + Intergenic
1043007778 8:74842091-74842113 ATGCAATCCATTATCCTTGAGGG + Intronic
1043740100 8:83800957-83800979 ACTCAGCCCAATATCAGTGATGG - Intergenic
1046639415 8:116710295-116710317 ATTCAAACTATTATTTGTAATGG + Intronic
1047141275 8:122142369-122142391 ATTTATCCCATCATCTGTCATGG + Intergenic
1048238789 8:132720004-132720026 ATTCAACACATTATCTGAGCAGG - Intronic
1050523147 9:6522931-6522953 TTTCAACCCATGACCTGAGATGG + Intergenic
1187214419 X:17262695-17262717 AGTCCACCCATTATCACTGAGGG + Intergenic
1187504601 X:19868779-19868801 AATCAACCCATTATAAGTCAGGG + Intronic
1189884304 X:45524950-45524972 ATGCAACCCATTGTGTGTGCAGG + Intergenic
1190179498 X:48179936-48179958 TTACAACCTATTATCTCTGAAGG - Intergenic
1193305042 X:79939349-79939371 ATTCAAATCATTATCTGATAAGG - Intergenic
1194680564 X:96847314-96847336 ATTCAACTCAGTATCTCTTAAGG - Intronic