ID: 1078547942

View in Genome Browser
Species Human (GRCh38)
Location 11:12259864-12259886
Sequence GCCGCCATTGGCACCCTGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 94}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078547939_1078547942 -3 Left 1078547939 11:12259844-12259866 CCGAAAGTTCTTGCGCAGTGGCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1078547942 11:12259864-12259886 GCCGCCATTGGCACCCTGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 94
1078547934_1078547942 17 Left 1078547934 11:12259824-12259846 CCCTCGGAGAGACACTCCCACCG 0: 1
1: 0
2: 0
3: 0
4: 58
Right 1078547942 11:12259864-12259886 GCCGCCATTGGCACCCTGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 94
1078547937_1078547942 0 Left 1078547937 11:12259841-12259863 CCACCGAAAGTTCTTGCGCAGTG 0: 1
1: 0
2: 3
3: 1
4: 40
Right 1078547942 11:12259864-12259886 GCCGCCATTGGCACCCTGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 94
1078547933_1078547942 18 Left 1078547933 11:12259823-12259845 CCCCTCGGAGAGACACTCCCACC 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1078547942 11:12259864-12259886 GCCGCCATTGGCACCCTGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 94
1078547936_1078547942 1 Left 1078547936 11:12259840-12259862 CCCACCGAAAGTTCTTGCGCAGT 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1078547942 11:12259864-12259886 GCCGCCATTGGCACCCTGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 94
1078547935_1078547942 16 Left 1078547935 11:12259825-12259847 CCTCGGAGAGACACTCCCACCGA 0: 1
1: 0
2: 1
3: 1
4: 53
Right 1078547942 11:12259864-12259886 GCCGCCATTGGCACCCTGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078547942 Original CRISPR GCCGCCATTGGCACCCTGGA AGG Exonic
900641595 1:3690331-3690353 GCCTCCCTTGGCACCCAGGTGGG - Intronic
901049432 1:6419006-6419028 GCGGCCAGCGCCACCCTGGACGG - Exonic
903151315 1:21411659-21411681 GGAGCTGTTGGCACCCTGGAGGG - Intergenic
904852293 1:33468198-33468220 GCAGGCATTGGCACACTGGCAGG - Intergenic
905001254 1:34671614-34671636 GGCACCATAGGCACCATGGATGG + Intergenic
917657165 1:177137975-177137997 CCTGCCCTTGGTACCCTGGATGG - Intronic
917854018 1:179087335-179087357 GCGCCCACTGGCACCCTGGCTGG - Intronic
1066198249 10:33122627-33122649 GCCTCCCTTGGCACCATGAAGGG + Intergenic
1067163658 10:43847907-43847929 GCTGGCCTAGGCACCCTGGATGG + Intergenic
1073643806 10:105278937-105278959 GCAGCCCTTGGCAGCCTGGAGGG + Intergenic
1076658674 10:132040985-132041007 TCTGCCATTTGCAGCCTGGATGG - Intergenic
1078547942 11:12259864-12259886 GCCGCCATTGGCACCCTGGAAGG + Exonic
1080881314 11:36323363-36323385 GCTACCTTTGGCACCCTGGTTGG - Intronic
1084571809 11:69964389-69964411 GCTGGCATTTGCACCCTGGATGG + Intergenic
1084894364 11:72254677-72254699 TCCCCCCTTGGCACCCTGGCCGG + Intergenic
1091294876 11:134466603-134466625 GCCGCGGTGGGCACCATGGAGGG + Intergenic
1092181961 12:6452243-6452265 GCCTCCATGGGCACACAGGAGGG + Exonic
1096515529 12:52153187-52153209 GGGGCCATGGGCAGCCTGGAAGG + Intergenic
1102973480 12:117189964-117189986 GCCGCCAGCGTCACCCTTGACGG + Intronic
1104639697 12:130459584-130459606 GCCGCCCTTAGCCCCCTTGATGG - Intronic
1105865603 13:24456441-24456463 GCTGTCATTAGCACCATGGAAGG - Exonic
1108542458 13:51456595-51456617 GGCGCCATGGGCACTGTGGATGG - Intergenic
1109618762 13:64872396-64872418 GCTGCCATTGGCAAGATGGATGG - Intergenic
1112181233 13:97083210-97083232 GTCACCATTGGCACCCAGGTTGG - Intergenic
1112298172 13:98207533-98207555 GCCGTCATCGGCTCCCTGGATGG + Intronic
1118522041 14:66596409-66596431 GGCACCATGGGCACCGTGGATGG - Intronic
1121276097 14:92668760-92668782 GCCGCCATGGGAACAGTGGAGGG + Intronic
1124439717 15:29677178-29677200 GCAGCATTTGGCACGCTGGAGGG - Intergenic
1128101153 15:65001044-65001066 GCCTCCATTGACACCCGTGAGGG + Intergenic
1129224854 15:74163185-74163207 GCTCCCATTGGCCCTCTGGAGGG + Intergenic
1129329399 15:74819251-74819273 GCAGCCACCGGCACCCTGGCAGG + Exonic
1130941249 15:88511153-88511175 GCTGCCACTGGGCCCCTGGATGG - Intergenic
1131563292 15:93462831-93462853 GCAGCCAGTGTCACTCTGGAAGG + Intergenic
1135962030 16:27003106-27003128 GCCTCCACTGACATCCTGGAGGG - Intergenic
1137441015 16:48498457-48498479 GCCTCCATTTCCACCCTGGTGGG - Intergenic
1140251231 16:73295972-73295994 GCCACTGTTGGCTCCCTGGATGG + Intergenic
1146705265 17:34996581-34996603 GCAGACATTAGCATCCTGGAAGG - Exonic
1148337057 17:46849064-46849086 GCCTCCATGGGCAAGCTGGAAGG + Intronic
1148697956 17:49572438-49572460 GCACCCATTTGCACCCTGGATGG - Intergenic
1148995102 17:51702669-51702691 TCTGCCATGGCCACCCTGGAAGG + Intronic
1151535599 17:74737288-74737310 GGCGCCGTTGCCACCCGGGATGG + Intronic
1151755904 17:76075130-76075152 GCCACCATCTACACCCTGGACGG + Exonic
1151819444 17:76489770-76489792 GACGCTAATGTCACCCTGGAAGG - Intronic
1152023873 17:77796434-77796456 GCAGCTTTGGGCACCCTGGAGGG + Intergenic
1156302504 18:35847763-35847785 GCCGCCATAGGCAGACTTGAGGG - Intergenic
1158909719 18:62047605-62047627 GCCTCCATTGGCACCCGAGAGGG - Intronic
1159859608 18:73631648-73631670 GCCTCCAGTGGCACCATGGAAGG + Intergenic
1162533024 19:11246745-11246767 GCCGCCATTGTCACTCTGCACGG + Intronic
1163847658 19:19646559-19646581 GCTGCCATGGGGAGCCTGGATGG - Intronic
1166708352 19:44921587-44921609 GCCGCGATTGTCATCCTGGCCGG + Intergenic
1167418477 19:49389540-49389562 GCCCCCCTTTGCACCCTGCAGGG + Intronic
927953584 2:27191280-27191302 GCCCCCATTAACACCCTGGGAGG - Intergenic
930971215 2:57397730-57397752 GATGCCATGGGCACCATGGATGG - Intergenic
931733971 2:65177608-65177630 GGTGCCATGGGCACCATGGATGG - Intergenic
946193799 2:218021690-218021712 GCTGCAATTGGAAGCCTGGATGG - Intergenic
1170837154 20:19894353-19894375 GCCAGCATTGGGAGCCTGGATGG - Intronic
1172695498 20:36819980-36820002 GCAGCCAGTGGGGCCCTGGACGG + Intronic
1174176680 20:48649894-48649916 GCCGCCATTCCAGCCCTGGACGG + Intronic
1179141626 21:38731006-38731028 GCAGCCATCTGCAACCTGGAAGG - Intergenic
1179967832 21:44817385-44817407 GTCGCGATGGGCGCCCTGGAAGG + Intronic
1184159428 22:42689082-42689104 GCCGCCACACCCACCCTGGAAGG - Intergenic
1184738001 22:46410397-46410419 GCCAACAATGGCACCCGGGAAGG - Exonic
949435301 3:4022914-4022936 ACTGTCATTGACACCCTGGAAGG + Intronic
950104256 3:10378349-10378371 GCCGCCCTCGGCACTCTTGAGGG + Exonic
950487395 3:13281704-13281726 TCCCCCATTTCCACCCTGGAAGG + Intergenic
950672713 3:14536783-14536805 GCCGCCATTGGGAAACTGAATGG - Intronic
953568065 3:44050246-44050268 GCCGTCAATGGCACCATGGAAGG - Intergenic
954133155 3:48570164-48570186 GCGGCCATCTTCACCCTGGATGG + Exonic
954615489 3:51967126-51967148 GGCGCCCTTGGCACCAGGGAGGG - Intronic
957787936 3:84905375-84905397 GTCGCCATGGGCACCGTGGCTGG + Intergenic
960366386 3:116777678-116777700 GAAGCCATTGGACCCCTGGAGGG + Intronic
962599732 3:136982602-136982624 GCTGACATTGGGAACCTGGAAGG + Intronic
964809840 3:160651757-160651779 GCAGCAAATGGCAGCCTGGAGGG - Intergenic
966850723 3:184163605-184163627 TCCTCCATTTGCACCCTAGAAGG + Intronic
966954111 3:184855717-184855739 GCCAGCAGTGGCACACTGGAAGG - Exonic
968044972 3:195618891-195618913 GCCGCCAGTGGCAGCCCCGAGGG + Intergenic
968060756 3:195724943-195724965 GCCGCCAGTGGCAGCCCCGAGGG + Exonic
968830644 4:2931594-2931616 CCGGGCATAGGCACCCTGGATGG + Exonic
971869419 4:32216298-32216320 GGTGCCATGGGCACCATGGACGG - Intergenic
978184061 4:105836499-105836521 GGTGCCATGGGCACCATGGATGG - Intronic
983552426 4:169031537-169031559 GCCACCACACGCACCCTGGAGGG + Intergenic
985532520 5:442583-442605 GCAGTCATTGGCACCCTCGTGGG - Exonic
987143233 5:14966462-14966484 GCCTCCATTGACACCATGAAGGG + Intergenic
987628915 5:20442198-20442220 ACTGTCATTGGCATCCTGGAGGG + Intronic
987841893 5:23232868-23232890 GCACCCATTGGAACCCTTGAGGG - Intergenic
991945426 5:71894421-71894443 GCCCCCATTGGCAGCCTGATGGG - Intergenic
992039196 5:72812705-72812727 GCCTCCACTGACACCCAGGATGG + Intergenic
993168270 5:84384202-84384224 GCCACCCTTGGCACGCCGGAGGG + Intronic
1007241061 6:40425512-40425534 GCCTCCTCTGCCACCCTGGAGGG - Intronic
1007258092 6:40542566-40542588 GCCCCCACTGGCAGCCTGGATGG - Intronic
1022156450 7:27665647-27665669 GCCTCCAGTGACACCATGGAGGG - Intergenic
1023966363 7:44965000-44965022 GCCGCCATGGGGGCCCTGCAAGG - Exonic
1024338066 7:48229462-48229484 GCAGCCCTTTGCACCCTGGCTGG + Intronic
1026895936 7:74010162-74010184 GTGGCCAGTGTCACCCTGGAGGG + Intergenic
1026896625 7:74013362-74013384 GCAGCCAGTGTCACCCTGGGGGG + Intergenic
1034958738 7:155351289-155351311 GCTGCCAGTGGCTCCCTGGCTGG - Intergenic
1037821033 8:22134604-22134626 GCCTCCAGTTGCACACTGGAGGG - Intergenic
1042856590 8:73273580-73273602 GGCGCCATGGGCACCATGGACGG + Intergenic
1049478555 8:142808126-142808148 GCTGCCAGTGCCACCGTGGATGG + Intergenic
1056755653 9:89380567-89380589 TCTGCCTTTAGCACCCTGGAAGG + Intronic
1058625887 9:106932317-106932339 GACGCCAGTGGCGCCCTGGTGGG + Intronic
1061631281 9:131873905-131873927 GGCGTCAGTGGCACCCTGGCTGG - Intronic
1187683495 X:21792566-21792588 GCCTCCATTGACACCATGGGCGG - Intergenic
1197774520 X:130110679-130110701 GCCGCCAATGGCAAGTTGGAGGG + Intronic
1200423427 Y:2997789-2997811 GCCAGCATTGGCAACCTGGTAGG - Intergenic