ID: 1078548946

View in Genome Browser
Species Human (GRCh38)
Location 11:12267319-12267341
Sequence GCTAAGGGCAGAGCCTGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078548946_1078548948 -8 Left 1078548946 11:12267319-12267341 CCAAAACAGGCTCTGCCCTTAGC No data
Right 1078548948 11:12267334-12267356 CCCTTAGCCTTCCCCATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078548946 Original CRISPR GCTAAGGGCAGAGCCTGTTT TGG (reversed) Intergenic
No off target data available for this crispr