ID: 1078549338

View in Genome Browser
Species Human (GRCh38)
Location 11:12269612-12269634
Sequence GAAGCCCTCATCCTGGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078549338_1078549343 6 Left 1078549338 11:12269612-12269634 CCAGTGTCCAGGATGAGGGCTTC No data
Right 1078549343 11:12269641-12269663 GGAGCTGCTCAGCTCTGCTGAGG No data
1078549338_1078549347 15 Left 1078549338 11:12269612-12269634 CCAGTGTCCAGGATGAGGGCTTC No data
Right 1078549347 11:12269650-12269672 CAGCTCTGCTGAGGGCCGTGGGG No data
1078549338_1078549345 13 Left 1078549338 11:12269612-12269634 CCAGTGTCCAGGATGAGGGCTTC No data
Right 1078549345 11:12269648-12269670 CTCAGCTCTGCTGAGGGCCGTGG No data
1078549338_1078549346 14 Left 1078549338 11:12269612-12269634 CCAGTGTCCAGGATGAGGGCTTC No data
Right 1078549346 11:12269649-12269671 TCAGCTCTGCTGAGGGCCGTGGG No data
1078549338_1078549350 21 Left 1078549338 11:12269612-12269634 CCAGTGTCCAGGATGAGGGCTTC No data
Right 1078549350 11:12269656-12269678 TGCTGAGGGCCGTGGGGAAGGGG No data
1078549338_1078549344 7 Left 1078549338 11:12269612-12269634 CCAGTGTCCAGGATGAGGGCTTC No data
Right 1078549344 11:12269642-12269664 GAGCTGCTCAGCTCTGCTGAGGG No data
1078549338_1078549348 19 Left 1078549338 11:12269612-12269634 CCAGTGTCCAGGATGAGGGCTTC No data
Right 1078549348 11:12269654-12269676 TCTGCTGAGGGCCGTGGGGAAGG No data
1078549338_1078549351 27 Left 1078549338 11:12269612-12269634 CCAGTGTCCAGGATGAGGGCTTC No data
Right 1078549351 11:12269662-12269684 GGGCCGTGGGGAAGGGGCTGAGG No data
1078549338_1078549349 20 Left 1078549338 11:12269612-12269634 CCAGTGTCCAGGATGAGGGCTTC No data
Right 1078549349 11:12269655-12269677 CTGCTGAGGGCCGTGGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078549338 Original CRISPR GAAGCCCTCATCCTGGACAC TGG (reversed) Intergenic
No off target data available for this crispr