ID: 1078550730

View in Genome Browser
Species Human (GRCh38)
Location 11:12278937-12278959
Sequence ATGTAAGTGTTCTGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 279}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078550724_1078550730 13 Left 1078550724 11:12278901-12278923 CCGGTGTCTTTGTGGATGTCAGG 0: 1
1: 0
2: 0
3: 21
4: 190
Right 1078550730 11:12278937-12278959 ATGTAAGTGTTCTGGGAGGCAGG 0: 1
1: 0
2: 0
3: 27
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078550730 Original CRISPR ATGTAAGTGTTCTGGGAGGC AGG Intronic