ID: 1078550848

View in Genome Browser
Species Human (GRCh38)
Location 11:12279718-12279740
Sequence CTGTCTCCACACATGGAACT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 209}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078550842_1078550848 20 Left 1078550842 11:12279675-12279697 CCTGCCTCTCTCTCTGCTGCTTT 0: 1
1: 0
2: 12
3: 142
4: 1453
Right 1078550848 11:12279718-12279740 CTGTCTCCACACATGGAACTCGG 0: 1
1: 0
2: 0
3: 14
4: 209
1078550841_1078550848 24 Left 1078550841 11:12279671-12279693 CCTTCCTGCCTCTCTCTCTGCTG 0: 1
1: 1
2: 17
3: 218
4: 1928
Right 1078550848 11:12279718-12279740 CTGTCTCCACACATGGAACTCGG 0: 1
1: 0
2: 0
3: 14
4: 209
1078550843_1078550848 16 Left 1078550843 11:12279679-12279701 CCTCTCTCTCTGCTGCTTTTACA 0: 1
1: 0
2: 5
3: 92
4: 865
Right 1078550848 11:12279718-12279740 CTGTCTCCACACATGGAACTCGG 0: 1
1: 0
2: 0
3: 14
4: 209
1078550846_1078550848 -8 Left 1078550846 11:12279703-12279725 CCATTGGCAGAGAGGCTGTCTCC 0: 1
1: 0
2: 2
3: 21
4: 206
Right 1078550848 11:12279718-12279740 CTGTCTCCACACATGGAACTCGG 0: 1
1: 0
2: 0
3: 14
4: 209
1078550840_1078550848 25 Left 1078550840 11:12279670-12279692 CCCTTCCTGCCTCTCTCTCTGCT 0: 1
1: 2
2: 25
3: 407
4: 3489
Right 1078550848 11:12279718-12279740 CTGTCTCCACACATGGAACTCGG 0: 1
1: 0
2: 0
3: 14
4: 209
1078550839_1078550848 30 Left 1078550839 11:12279665-12279687 CCTCTCCCTTCCTGCCTCTCTCT 0: 1
1: 6
2: 136
3: 954
4: 5493
Right 1078550848 11:12279718-12279740 CTGTCTCCACACATGGAACTCGG 0: 1
1: 0
2: 0
3: 14
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078550848 Original CRISPR CTGTCTCCACACATGGAACT CGG Intronic
900970317 1:5989030-5989052 CTCTCCCCATACATGGAATTGGG - Intronic
901254594 1:7811598-7811620 CTGTGTCCTCACATGGCACAAGG + Intronic
901375977 1:8839834-8839856 CTTTCTCTACACTTGCAACTTGG + Intergenic
901415012 1:9110639-9110661 CAGTCTGCACATGTGGAACTAGG - Intronic
902047166 1:13533914-13533936 CTGTCGCCAAACATGGACTTGGG + Intergenic
903985264 1:27222886-27222908 CTGTGTCCTCACATGGCAGTAGG + Intergenic
904390507 1:30182540-30182562 CTTTCTCAACATATGGCACTTGG + Intergenic
904574093 1:31491535-31491557 CTGTCCCCACCCTAGGAACTGGG + Intergenic
907934737 1:59032119-59032141 CTGTGTCCTCACATGGTACAAGG - Intergenic
909239389 1:73192840-73192862 CTGTGTCCTCACATGGAAGAAGG + Intergenic
911818715 1:102388287-102388309 CTTTCTGCTCACATGGAATTTGG + Intergenic
913002604 1:114596200-114596222 CTGTCTCTACACATTTAGCTGGG + Intronic
913971385 1:143420715-143420737 CTGCCTCCCCACGTGGAACGAGG - Intergenic
914065762 1:144246328-144246350 CTGCCTCCCCACGTGGAACGAGG - Intergenic
914113389 1:144720026-144720048 CTGCCTCCCCACGTGGAACGAGG + Intergenic
914424084 1:147558586-147558608 ATGTCTCCACAGATAGAACCAGG - Intronic
916261267 1:162844679-162844701 GTGTCTCCACCCCTGGAACAGGG + Intronic
918533535 1:185549367-185549389 CTGTCTCCATAAATGGCACTTGG - Intergenic
919289303 1:195609071-195609093 CTGTCTGCACACATTGGTCTAGG + Intergenic
920758843 1:208762076-208762098 ATGTCTCCACACATTGCCCTGGG - Intergenic
924605354 1:245529609-245529631 CTATTTTCACACAGGGAACTTGG + Intronic
1063465802 10:6243523-6243545 CTGCCTCCACTGATGGGACTAGG - Intergenic
1064158553 10:12923748-12923770 CCGTCTCCATGCCTGGAACTGGG + Intronic
1065238863 10:23685643-23685665 CTGTCTCCTCACATGAAAGAGGG + Intergenic
1065328008 10:24567708-24567730 GGGTCTCCACACTTGGAACATGG + Intergenic
1067016517 10:42759686-42759708 CTCTCTCTAAACATGGAACGGGG + Intergenic
1068765811 10:60762460-60762482 CTGTCTCAAGACAGTGAACTGGG - Intergenic
1069861736 10:71475813-71475835 CTGACCCCAGGCATGGAACTGGG - Intronic
1071924947 10:90395443-90395465 CTGTTTCCTCACATGGCAGTGGG + Intergenic
1072112202 10:92333360-92333382 CTATCTCAGCACATGGTACTTGG - Intronic
1073035847 10:100563729-100563751 CTGTCTCCACACCAGGTACTGGG - Intergenic
1074270596 10:111949895-111949917 CTGTGTCCTCACATGGTACAAGG - Intergenic
1074924323 10:118051971-118051993 CTCTCTCCAAACTTGGATCTTGG + Intergenic
1075639802 10:124056525-124056547 CTGTCCCCACACTTGGCACCAGG - Intronic
1076894551 10:133303446-133303468 CTCCCTCCACACATGGGTCTGGG + Intronic
1077019269 11:410325-410347 CTGTCTCCCGACATGGCAGTTGG + Intronic
1078550848 11:12279718-12279740 CTGTCTCCACACATGGAACTCGG + Intronic
1079607172 11:22384587-22384609 CTGTCTCCATAAATGGAAGGTGG + Intergenic
1084994142 11:72958888-72958910 CTGTTTCCATAGATGGAAATGGG - Intronic
1085064537 11:73481951-73481973 CTGTGTCCTCACATGGCTCTAGG - Intronic
1085475852 11:76788478-76788500 CTGGCGCCACACTGGGAACTTGG + Intronic
1085520161 11:77133040-77133062 CTGTCTCCCCACATAGGTCTGGG - Intronic
1088816789 11:113426736-113426758 ATGTCACCCCACATGGAATTAGG - Intronic
1089538488 11:119175034-119175056 CTGGCTCCACACATGGGGCCAGG - Exonic
1091696144 12:2629556-2629578 CTGTTTCCACACCTAGAACATGG - Intronic
1092872630 12:12819687-12819709 TGGTTTCCACACAGGGAACTTGG - Intronic
1093197935 12:16150782-16150804 CTGTCACCACAAATGGGCCTGGG - Intergenic
1093955042 12:25207190-25207212 CAGTCACCACACAAGGCACTGGG - Intronic
1096727507 12:53576533-53576555 CTGTGTCCTCACATGGCAGTTGG - Intronic
1097073683 12:56376284-56376306 CTGTGTCCTCACATGGCACATGG + Intergenic
1097325553 12:58272418-58272440 CTGTGTCCTCACATGGCAGTAGG + Intergenic
1098636123 12:72785847-72785869 CTCTCTCCACACAGGCAACAAGG - Intergenic
1100615736 12:96230572-96230594 CTGTCTCCACCCTGGGGACTTGG - Intronic
1100618301 12:96248597-96248619 CATTTTCCACACATGGAACCTGG - Intronic
1101691716 12:107088530-107088552 CTGTCTCCTCACATGGCAGAAGG - Intronic
1102879496 12:116473519-116473541 CTGTATCCTCACATGGAAGAAGG - Intergenic
1103372913 12:120433072-120433094 CTGTCTGCACACATCACACTCGG - Intergenic
1110136504 13:72073777-72073799 CTGTATCCTCACATGGAAGCGGG - Intergenic
1110727290 13:78840033-78840055 CTGTGTCCACACATGGTAGAAGG + Intergenic
1112399679 13:99065137-99065159 CTCTCTCCACACAGTGAGCTTGG - Intronic
1112427377 13:99315381-99315403 CTGTCTCCAGCCATGAGACTTGG + Intronic
1113581218 13:111430882-111430904 GTGTCTCCCCAGATGGAACAAGG + Intergenic
1114068917 14:19093125-19093147 CTCTCTCTAAACATGGAACAGGG - Intergenic
1114093344 14:19306880-19306902 CTCTCTCTAAACATGGAACAGGG + Intergenic
1114344834 14:21783530-21783552 CTGTATCCAAACATGCAGCTGGG + Intergenic
1114381383 14:22208156-22208178 CTGTCTCCAAACCTGCAGCTGGG + Intergenic
1114584535 14:23798279-23798301 CTGTCTCCTCACATGGAAGAAGG - Intergenic
1119456734 14:74762666-74762688 CTGTCTCAACACATATAAATCGG - Intergenic
1121464499 14:94106113-94106135 CTGTGTCCTCACATGGTAGTGGG + Intronic
1121941788 14:98077728-98077750 CTGTGTCCTCACATGGCACAAGG + Intergenic
1124047291 15:26162020-26162042 CTGTTTTCTTACATGGAACTGGG + Intergenic
1126200343 15:45978678-45978700 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1126618223 15:50608547-50608569 CTGTCTCCACTGATGAAAATAGG - Intronic
1127066511 15:55245217-55245239 CTGTCTCCACTTATGGAAATGGG - Intronic
1128688406 15:69704715-69704737 CTGTCTGCACACCTTGATCTTGG - Intergenic
1128888165 15:71307303-71307325 CCGTCTTCCCACATGTAACTTGG + Intronic
1128907904 15:71484699-71484721 CTGTTTCCACACCTGCAAATGGG - Intronic
1128945007 15:71813909-71813931 CTGGCTGCAGACATGGACCTGGG - Intronic
1129504332 15:76068643-76068665 CTGTGTCCTCACATGGAAGCAGG - Intronic
1129760754 15:78128125-78128147 CTGTGGCCACACAAGGGACTGGG + Intronic
1130096205 15:80858015-80858037 CAGTCTCCACCCATGCAACATGG - Intronic
1130629868 15:85556151-85556173 CAGTTTCCACACATGCAACATGG + Intronic
1130993628 15:88891857-88891879 CAGGCTCCACACCTGGAACCAGG + Intronic
1134107863 16:11496756-11496778 CTGTCTCCACACGTCCCACTGGG + Intronic
1137775893 16:51054057-51054079 CTGTCTGCACAGATAAAACTTGG + Intergenic
1137821937 16:51454397-51454419 CTCTCTAAACACATGGGACTTGG + Intergenic
1138161317 16:54757531-54757553 CTTTCTCAAGACATGGGACTCGG - Intergenic
1138247092 16:55475866-55475888 CTGTGCCCTCACATGGAAATAGG - Intronic
1138397160 16:56713860-56713882 CTGTCTCCTCACATGGCAGAAGG + Intronic
1141357545 16:83362589-83362611 CTGTGTCCTCACATGAAACATGG - Intronic
1141853586 16:86665325-86665347 TTGTCTCCACACATGTAGCTGGG - Intergenic
1145992019 17:29085082-29085104 CTTTCTCCAAACAAGAAACTGGG + Intronic
1148971937 17:51491261-51491283 CTGTGTCCTCACATGGAAGAAGG - Intergenic
1149287872 17:55185950-55185972 GTGCCTCCACACATGGATCCTGG - Intergenic
1152295737 17:79466062-79466084 GTGTCTCCACACATGCACTTTGG - Intronic
1155267278 18:24106221-24106243 GTGTCTCCCCACAGGCAACTGGG + Intronic
1158070336 18:53462742-53462764 ATGTCTCCCATCATGGAACTGGG - Intronic
1161124383 19:2547586-2547608 GTGTCACCACACATGGAAAAAGG - Intronic
1162033787 19:7928295-7928317 CTGCCTCCCCACTTGGACCTGGG - Intronic
1163011445 19:14429084-14429106 CTGCCTCCCCAGATGGAGCTGGG - Intergenic
1163195628 19:15717639-15717661 CTGTGTCAAAACATGGACCTGGG + Intergenic
1163335297 19:16667389-16667411 CTCTTTCCTCACATGGAGCTTGG - Intronic
1165270884 19:34706483-34706505 TTGGCTCCACCCATGGAGCTGGG + Intergenic
925269136 2:2589973-2589995 CCCTCTCCACCTATGGAACTAGG - Intergenic
926143955 2:10385465-10385487 GTGTCTGCACCCAAGGAACTTGG - Intronic
927671861 2:25075051-25075073 CAGTATCCACACCAGGAACTTGG + Intronic
931492268 2:62761216-62761238 CTGTCAACAGACATGGAAATAGG + Intronic
938844601 2:135195708-135195730 CTCTCTCCCCACATCAAACTGGG - Intronic
943635443 2:190301800-190301822 GTGTGTCCACACATGGCACAAGG + Intronic
943720521 2:191199198-191199220 CCGTCTCCTCATATGGAAGTAGG - Intergenic
946122375 2:217527618-217527640 CTGTCTCCTGAGAAGGAACTGGG + Intronic
946439068 2:219679788-219679810 CTGTGTCCTCACATGGTACAAGG + Intergenic
1170173702 20:13443364-13443386 CTATATCCACAGAGGGAACTGGG + Intronic
1172711165 20:36924750-36924772 CTGTTTCCACACTTGTTACTTGG - Intronic
1175756816 20:61535420-61535442 CTGCCTCGACAAATGGACCTGGG - Intronic
1179522843 21:41956340-41956362 CTGTGTGCACACATGGCACGGGG - Intergenic
1179646579 21:42779614-42779636 CTGTCTCCAAATACGGTACTGGG - Intergenic
1180487389 22:15815685-15815707 CTCTCTCTAAACATGGAACAGGG - Intergenic
1181261980 22:21604879-21604901 CTCTCACCACCCAGGGAACTTGG - Intronic
1181360505 22:22330634-22330656 CTGTGTCCTCACAGGAAACTGGG + Intergenic
1181364375 22:22363850-22363872 CTGTGTCCTCACAGGGAACCAGG + Intergenic
1182258252 22:29053520-29053542 CTGGCACCACACATGGGACCAGG - Intronic
1184142728 22:42587685-42587707 CTGGCTCCACAGATGGAGATGGG + Intronic
1184885939 22:47344580-47344602 CTGTCTCCCCACATGGCTCTGGG - Intergenic
949430505 3:3970696-3970718 ATGTCTCCACACATTCAAATAGG + Intronic
950505099 3:13389600-13389622 CTGTCTCCACAAGGGCAACTCGG + Intronic
952004036 3:28821845-28821867 CTGTGTCCTCACATGGCAATAGG + Intergenic
956596842 3:70976541-70976563 CTATCTCCAGAGATGGAACCTGG - Intronic
956921290 3:73932349-73932371 ATGTCTCCTCACATGCCACTGGG + Intergenic
958880565 3:99664645-99664667 AGGTCTCCACACAGGGAAGTGGG - Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
961594314 3:128005134-128005156 CTGTCTCCTCACTTGTGACTTGG - Intergenic
962840500 3:139228128-139228150 CTGTCTCGAGACATGGAATCTGG + Intronic
962933981 3:140062503-140062525 AAGTCTGCTCACATGGAACTGGG - Intronic
963067002 3:141271928-141271950 CTGTCGCCACAGAAGGAAGTGGG + Intronic
963071067 3:141305733-141305755 CTGTGTCCACACATGGGGGTGGG - Intergenic
966450013 3:180048426-180048448 CTAGGTCCACACATGGAACAAGG - Intergenic
966909670 3:184551979-184552001 CTGTCTCCTCACCTGGAAAATGG - Intronic
969218334 4:5741396-5741418 TTTTCTTCACACATGGAAATGGG + Intronic
970264836 4:14270722-14270744 CTATCTCCAAAGATGCAACTTGG - Intergenic
970294319 4:14612205-14612227 CTGTCATCACACATGGTCCTGGG + Intergenic
971362573 4:25951390-25951412 CTGCCTCCAGACATGGAGGTGGG - Intergenic
973588335 4:52414342-52414364 CTCTCTCCACACAGGGCAATGGG - Intergenic
974335382 4:60537266-60537288 CTATCTACACACATGTACCTGGG + Intergenic
976387226 4:84474978-84475000 GAGTCTGTACACATGGAACTTGG + Intergenic
976761569 4:88554742-88554764 CTGACTCTACCCATGGAGCTAGG - Intronic
978411309 4:108429112-108429134 CTGTCTCCAGGCATGGGCCTTGG + Intergenic
981113928 4:140967931-140967953 CTGTGTCCACACATCTCACTGGG - Intronic
985354392 4:189102240-189102262 CTGTCTCTACACATGGACGTGGG + Intergenic
985528880 5:422174-422196 CTGTCGCCAGACATGGACCCTGG + Intronic
986962957 5:13237812-13237834 ATGTCCCCACACATGGACATAGG - Intergenic
988600147 5:32632172-32632194 CTGCCTCCACAGATGGAGCAAGG - Intergenic
989209013 5:38841654-38841676 CTGTGTCCCCACCTGGCACTTGG - Intergenic
990182688 5:53180036-53180058 ATGTGGCCAAACATGGAACTTGG + Intergenic
992495575 5:77290128-77290150 CATTTTCCACACGTGGAACTAGG - Intronic
993940892 5:94057795-94057817 CTGTCTCCACACAGTAAGCTAGG - Intronic
995143921 5:108764993-108765015 TTGTCTTCACAAATGGGACTAGG - Intronic
997476241 5:134144221-134144243 CTGTCCCCACACAGGGAAGCTGG + Intronic
998099370 5:139419368-139419390 CTGTCTCCAGAGAGGGAAATAGG + Intronic
998249199 5:140538925-140538947 GTGCCTCCATACATGGAAATTGG - Exonic
998984823 5:147744743-147744765 CTATATCCACACAAGGATCTGGG - Intronic
1002195828 5:177500783-177500805 CTCCCTCCACACATGGAATCTGG - Intergenic
1003644645 6:7904712-7904734 CAGTGTCCACACCTGGAACAAGG + Exonic
1004639747 6:17503737-17503759 CTTTCTCCAAATATGGTACTGGG + Intronic
1004826314 6:19425321-19425343 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1006175324 6:32117847-32117869 CTCTCTCCTCACCTGAAACTGGG + Exonic
1010388154 6:75306009-75306031 CTGTCTTCACAAATGGAAGTTGG + Intronic
1011756097 6:90499637-90499659 CTGTGTCCTCACATGGTACAAGG + Intergenic
1012960482 6:105616661-105616683 CTGTCCCCACAGATGGAATGAGG - Intergenic
1013807353 6:114010685-114010707 CTGTCTACACACAGGGATCAGGG + Intronic
1014089605 6:117388822-117388844 CAGTTTCCACACCTGGAAATGGG - Intronic
1015389726 6:132668004-132668026 ATGTCTCCACATGTGGAATTTGG + Intergenic
1017064807 6:150518952-150518974 CTGTCTCCAAATAGGGAACAGGG + Intergenic
1017207546 6:151819772-151819794 ATTTTTCCACAGATGGAACTGGG - Intronic
1019041379 6:169108889-169108911 CTGGGCCCACCCATGGAACTAGG + Intergenic
1019315025 7:380325-380347 CGGACTCCACACATGGATTTGGG + Intergenic
1019873445 7:3788828-3788850 CTGTCTCCTCTCTCGGAACTGGG - Intronic
1020650503 7:10869077-10869099 CTGTCTGCAAGCTTGGAACTGGG - Intergenic
1022415981 7:30177375-30177397 CTGTCTCCACTCAAAGGACTTGG - Intergenic
1023216262 7:37866397-37866419 CTTTCTACACACATGGAAGCCGG - Intronic
1023239473 7:38128415-38128437 CTGTCTTCACTAATGTAACTGGG - Intergenic
1023561151 7:41474492-41474514 CTGTCTCCACACATGATACCAGG + Intergenic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1025223915 7:57140105-57140127 CTCTCTCCACAGTTGGAATTGGG + Intergenic
1025745745 7:64241314-64241336 CTGTCTCCACAATTGGGATTGGG - Intronic
1029045818 7:97627105-97627127 CTCTCTCCACAGACGGAAGTAGG - Intergenic
1029804427 7:102981692-102981714 CTGTGTCCACACATGGCAGTAGG + Intronic
1035478340 7:159159502-159159524 CTGTCTTTCCAGATGGAACTGGG - Intergenic
1035530722 8:349023-349045 ATGTCTCCACAGCTTGAACTAGG + Intergenic
1036911754 8:12763376-12763398 CTGTATCCCCACATGGAAGAAGG + Intergenic
1040488443 8:47896715-47896737 CACTCTCCACACATGGCACAGGG + Intronic
1041257623 8:55992785-55992807 CTGTGTCCTCACATGGAAGAAGG + Intronic
1041756611 8:61320677-61320699 CTGTGTCCTCACATGGTAGTAGG + Intronic
1044317528 8:90767166-90767188 CAATCTTCACACATGGAATTTGG - Intronic
1047466021 8:125115193-125115215 TTGACTCCACCCATGGAAATGGG + Intronic
1047712938 8:127570011-127570033 CTGTCTCCACACTTGGAGGAGGG + Intergenic
1047721162 8:127641006-127641028 CTGTCTCCCCAGATGGAGCATGG - Intergenic
1048561330 8:135540807-135540829 CTGTTTTCATACATGGGACTTGG - Intronic
1048619183 8:136113125-136113147 CTGTGTCCTCACATGGTAATGGG - Intergenic
1050346227 9:4690935-4690957 CACTCTCCACTGATGGAACTTGG - Intronic
1050797543 9:9562896-9562918 ATGTCTGCCCACATGGAGCTTGG - Intronic
1051508389 9:17849869-17849891 CTGTGTCCTCACATGGCACAAGG + Intergenic
1052327148 9:27227589-27227611 CTGTGTCCTCACGTGGCACTAGG + Intronic
1052601776 9:30642274-30642296 CTGTTTCCACACAAGAAATTTGG - Intergenic
1052672823 9:31580189-31580211 ATGTCTCCACTCATGGAGCTTGG - Intergenic
1053044248 9:34900837-34900859 CTGTGTCCTCACATGGAAGAAGG - Intergenic
1056465161 9:86846643-86846665 ATGTCTCCACTCCAGGAACTGGG - Intergenic
1056588415 9:87944482-87944504 CTGTCTGCACACACGGACTTCGG - Intergenic
1057187633 9:93065829-93065851 ATGTCTCCAGATATGGAGCTTGG + Intronic
1058572603 9:106363788-106363810 CTGTGTTCTCACATGGAACAAGG + Intergenic
1059856760 9:118407448-118407470 CCTTCTCCACCCATGGGACTGGG - Intergenic
1060423125 9:123483591-123483613 CAGTCACCACACATGGAACCCGG - Intronic
1061379243 9:130244171-130244193 CTGTTTCCTCATCTGGAACTGGG - Intergenic
1186083698 X:5962785-5962807 CTGTGTCCTCACATGGAAAAAGG - Intronic
1186661603 X:11673088-11673110 CAGTCTCCTCATCTGGAACTTGG + Intergenic
1188112849 X:26212635-26212657 CTGTCTCCTCACATGAAAGAAGG - Intergenic
1189668682 X:43384637-43384659 CTGTGTCCTCACATGGCACAAGG - Intergenic
1192849942 X:74943888-74943910 TTTTCTCAACACATGGTACTGGG - Intergenic
1192958324 X:76097087-76097109 CTTTTTCTACAAATGGAACTGGG + Intergenic
1196286462 X:113886707-113886729 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1198019380 X:132643390-132643412 CAGTTTCCACACATGGGACATGG - Intronic
1199251831 X:145672630-145672652 CTGTCACTGAACATGGAACTGGG - Intergenic
1200012098 X:153127056-153127078 CTGTCTCCACGCAGGGCACCTGG + Intergenic
1200027502 X:153272863-153272885 CTGTCTCCACGCAGGGCACCTGG - Intergenic