ID: 1078554112

View in Genome Browser
Species Human (GRCh38)
Location 11:12304707-12304729
Sequence TGTCACTGTAATACAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078554112_1078554116 8 Left 1078554112 11:12304707-12304729 CCTCCCACTGTATTACAGTGACA 0: 1
1: 0
2: 2
3: 13
4: 108
Right 1078554116 11:12304738-12304760 ATAAATTAGGCAGTCTGTTTTGG 0: 1
1: 0
2: 0
3: 17
4: 191
1078554112_1078554115 -5 Left 1078554112 11:12304707-12304729 CCTCCCACTGTATTACAGTGACA 0: 1
1: 0
2: 2
3: 13
4: 108
Right 1078554115 11:12304725-12304747 TGACAGTTTTGTTATAAATTAGG 0: 1
1: 0
2: 2
3: 41
4: 412
1078554112_1078554117 9 Left 1078554112 11:12304707-12304729 CCTCCCACTGTATTACAGTGACA 0: 1
1: 0
2: 2
3: 13
4: 108
Right 1078554117 11:12304739-12304761 TAAATTAGGCAGTCTGTTTTGGG 0: 1
1: 0
2: 1
3: 19
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078554112 Original CRISPR TGTCACTGTAATACAGTGGG AGG (reversed) Intronic
901119521 1:6879668-6879690 TGCCACTGCACTCCAGTGGGCGG - Intronic
903191349 1:21658013-21658035 CGCCACTGTCATTCAGTGGGTGG + Intronic
908352194 1:63297300-63297322 TGTCTCTATAATACATTGGTTGG - Intergenic
909000183 1:70208304-70208326 AGTTACTGTAATACAGTGTATGG + Intronic
914202245 1:145496014-145496036 TGCTACTGTCATGCAGTGGGTGG - Intergenic
914236173 1:145813929-145813951 TGCTACTGTCATGCAGTGGGTGG - Intronic
914481371 1:148069156-148069178 TGCTACTGTCATGCAGTGGGTGG - Intergenic
916877507 1:168985412-168985434 TGTCACAGTATTACAGAGGATGG - Intergenic
917273866 1:173308941-173308963 AGTCACTGGAATGCAGTGGAAGG - Intergenic
918559554 1:185848226-185848248 TGCTACTTTGATACAGTGGGAGG - Intronic
919854785 1:201697803-201697825 TGTCACTTTAAAACAATGTGTGG + Intronic
922052988 1:222012046-222012068 TGTCACTCTAGTACAGGGAGGGG + Intergenic
923899842 1:238313791-238313813 TGTCAGTGTGATACAGCAGGAGG + Intergenic
1063982577 10:11466827-11466849 GGTCACTGGAACACAGTGGTAGG + Intronic
1064465926 10:15581885-15581907 TGCCAAAGTAATTCAGTGGGGGG + Intronic
1068989460 10:63135240-63135262 TGGCAATGAAATACAGTGGATGG + Intronic
1071823059 10:89297475-89297497 TGTCACTGTAGCCCACTGGGTGG - Intronic
1073433225 10:103500328-103500350 TGTCACTGTTTTACAGATGGGGG + Intronic
1075959221 10:126552894-126552916 TGCCACTGCAATACACTTGGAGG + Intronic
1076139273 10:128066489-128066511 TGTCACTGTGCTACTGAGGGAGG - Intronic
1078416561 11:11171073-11171095 TGCCTCTGTTATACACTGGGAGG - Intergenic
1078554112 11:12304707-12304729 TGTCACTGTAATACAGTGGGAGG - Intronic
1079764810 11:24378798-24378820 TTTCACTGGAATATAGTAGGAGG - Intergenic
1080564817 11:33498350-33498372 TCTCATTGGAATACAGTGTGTGG + Intergenic
1081697901 11:45130006-45130028 TGCCACTGCAATCCAGTGGGTGG + Intronic
1083474613 11:62908005-62908027 TTTCACTGTAATAAACTGTGAGG + Intergenic
1085999873 11:81970174-81970196 TGTCTCTGCTATCCAGTGGGTGG - Intergenic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1100866190 12:98859418-98859440 TTTTACTGTAATTCAGTGCGGGG + Intronic
1101480032 12:105087797-105087819 TGTCCCTGGAATGCAGTGGTGGG + Intergenic
1117767939 14:59102272-59102294 TGTCACAGCAATACAGTTTGGGG - Intergenic
1118193268 14:63600451-63600473 TGTCACTGTCATACAGCCTGGGG + Intronic
1121321370 14:92993587-92993609 TGTCCCGGTAACACAGTGGCTGG - Intronic
1122580409 14:102768283-102768305 TGTCACTGTAATACTGTGGAAGG - Intergenic
1125121883 15:36169606-36169628 TGTAACTGTCATACAATAGGAGG + Intergenic
1125687898 15:41574361-41574383 TATCACTGTAGCAAAGTGGGTGG - Intronic
1134614575 16:15641155-15641177 TTTCTCTGTAATGCAGTGGCGGG - Intronic
1136004834 16:27322127-27322149 TGTAATTGTATTACGGTGGGAGG - Intronic
1137243920 16:46687585-46687607 CTTAACTGTAATACAGTGTGTGG - Intronic
1137309212 16:47236733-47236755 TATCACTGTAAAACTGTGGATGG - Intronic
1137699972 16:50490463-50490485 TTTCACTTTAATACAGTGCTTGG + Intergenic
1139824688 16:69747715-69747737 TGCCACTGAGATACGGTGGGAGG + Intronic
1141439830 16:84022885-84022907 TGACACTGTAAGACAGAGGGCGG + Exonic
1144234285 17:13242158-13242180 TGTCACTGTCACACAGATGGTGG + Intergenic
1145104077 17:20100407-20100429 TGTCACAGTAAAATATTGGGAGG - Intronic
1147344734 17:39782349-39782371 TGCCACTGTACTCCAGTGTGAGG + Intronic
1147485243 17:40806460-40806482 TGAGACTTTAATTCAGTGGGTGG - Intergenic
1150425329 17:65072966-65072988 GGTCACTGTGATTCAGAGGGTGG - Intergenic
1151984935 17:77536121-77536143 TGTCAATGGCATACAGTGGGTGG + Intergenic
1154466075 18:14643405-14643427 TGTCTCTGCAACACAGTGAGAGG - Intergenic
1155993638 18:32306470-32306492 TGTTACTGTCATTTAGTGGGTGG - Intronic
1158143880 18:54288478-54288500 TGTCATGGTAATTCAGTGGGTGG - Intronic
1161145888 19:2677811-2677833 TGTCCCTGGCATAGAGTGGGTGG + Intronic
1163336108 19:16672916-16672938 TGCCACTGTCATCTAGTGGGTGG + Intronic
1164042025 19:21501196-21501218 TGTACCTGTAATACTGTGGCAGG - Intronic
1164517332 19:28947677-28947699 TGCTATTGGAATACAGTGGGTGG + Intergenic
926661519 2:15472331-15472353 TGTCACTGAAACTCAGTGGGAGG - Intronic
928160963 2:28924134-28924156 TGTGGCTGAAATACAGTGAGGGG + Intronic
929579677 2:43073995-43074017 TGTCAGGGTACTACACTGGGGGG - Intergenic
929694549 2:44103013-44103035 TGTCCCTGTGATACAGTGGGGGG + Intergenic
933031955 2:77339654-77339676 AATCAGTGTAATACAGTCGGGGG - Intronic
933044212 2:77514443-77514465 TTTGACTGTTATGCAGTGGGTGG - Intronic
938645190 2:133323470-133323492 GGTCACGGTAATACTGAGGGAGG + Intronic
938861415 2:135373529-135373551 TGTAACTGTAGTACTTTGGGAGG + Intronic
939583395 2:143978270-143978292 TGTCATTGTAATACAGTATTTGG - Intronic
939660205 2:144879931-144879953 TTTCACAGTAAAACAGTGGAGGG - Intergenic
942392605 2:175511311-175511333 TGTCACTGCACTACAGTGGCAGG + Intergenic
944733696 2:202540867-202540889 TGTCATTTTAATAGGGTGGGAGG + Intronic
1172821721 20:37741509-37741531 TGTCACTGGAACACAGAGCGTGG - Intronic
1172917780 20:38456451-38456473 AGTCCCTGTGACACAGTGGGTGG + Intergenic
1175135365 20:56819397-56819419 TGTTACTGGCATAGAGTGGGTGG - Intergenic
1176808510 21:13515191-13515213 TGTCTCTGCAACACAGTGAGAGG + Intergenic
1181267104 22:21636775-21636797 TGTCTCTGTGCTGCAGTGGGAGG - Exonic
949959535 3:9300766-9300788 TGTTACTGGAAACCAGTGGGTGG + Intronic
951467252 3:23014578-23014600 TATCACGGTGATATAGTGGGGGG + Intergenic
951833134 3:26952093-26952115 TGGTAATGTAATACTGTGGGTGG - Intergenic
952158970 3:30674225-30674247 TCTCGCTGTAATGCAGTGGGAGG + Exonic
954584675 3:51722793-51722815 TGCCAATATAATGCAGTGGGAGG - Intergenic
956231820 3:67025908-67025930 TGTCACTGCAGTGCAGTGGCGGG + Intergenic
957658508 3:83115162-83115184 TTTCATTGAAAAACAGTGGGAGG + Intergenic
963466407 3:145687632-145687654 TATCACTGTAACCCAGTGGGTGG + Intergenic
964283133 3:155088766-155088788 GGTCACTTTAAGAGAGTGGGTGG + Intronic
966640510 3:182184399-182184421 TGCCACTGTAATAATGTGGAAGG - Intergenic
971373959 4:26041256-26041278 TGTTACTGGAATCTAGTGGGTGG + Intergenic
974660231 4:64878881-64878903 TCTCACTTTGATACATTGGGTGG + Intergenic
977258073 4:94762201-94762223 TGGCACTGTTATACACTGTGGGG + Intronic
981701611 4:147613523-147613545 TGCCACTGAAATACAGTGGTAGG + Intergenic
982571353 4:157053944-157053966 TCTCACTGTCATTCAGTTGGTGG + Intergenic
984088931 4:175346258-175346280 GGTCATTATAATACAGTGCGAGG - Intergenic
984785540 4:183564320-183564342 TGTCACTGTAATATGGGGGTTGG + Intergenic
990508869 5:56471778-56471800 TGTCTCTGTAATACCTTTGGTGG + Intronic
993092498 5:83443381-83443403 TGTCACTGGATGACAGTGAGAGG + Intergenic
998250521 5:140549123-140549145 TGCCACTGTGACACAGTGCGGGG + Intronic
1001565113 5:172695157-172695179 TGGGACCGTAATACAATGGGTGG - Intergenic
1004541807 6:16557725-16557747 TGTCACTGCACTTTAGTGGGAGG + Intronic
1005258696 6:24033440-24033462 TGTCACTGTGCTCTAGTGGGTGG + Intergenic
1007934243 6:45719031-45719053 AGTGACTGTAATTCAGTGGGTGG + Intergenic
1008625177 6:53308750-53308772 TGTCTCTGTAATACAGTGTATGG - Intronic
1012078204 6:94722008-94722030 TGTCACTGTCATTGAGTGGAAGG - Intergenic
1014242707 6:119035317-119035339 TGTCCCTGAATTCCAGTGGGAGG - Intronic
1014344402 6:120249979-120250001 TGTCACTGTAATACATGAGCAGG - Intergenic
1017444367 6:154493955-154493977 TGTCACTGGAACACATTAGGGGG - Intronic
1017518101 6:155176105-155176127 TGTGTCTGGAATTCAGTGGGAGG + Intronic
1023668762 7:42554321-42554343 TGTCAGTGTGATGCAGTGGGGGG + Intergenic
1027922715 7:84416168-84416190 TGTCAGAGGAACACAGTGGGAGG + Intronic
1039422015 8:37451091-37451113 TGTCTCTGCATCACAGTGGGAGG - Intergenic
1041176162 8:55198840-55198862 TCTCACTATAACAAAGTGGGGGG - Intronic
1041774027 8:61504660-61504682 TGCTACTGCCATACAGTGGGTGG - Intronic
1042168007 8:65965288-65965310 AGTGAATGTAATACAGTAGGGGG + Intergenic
1048089299 8:131221491-131221513 TATCACATTTATACAGTGGGAGG - Intergenic
1050461597 9:5881983-5882005 TGTCACTGTCATGCAGTAAGTGG + Intronic
1052808225 9:33032476-33032498 TGTCACTGTAACACAGCTGAGGG + Intronic
1053647990 9:40135118-40135140 TGTCACTGTACTCCAGTCTGCGG + Intergenic
1054536590 9:66241053-66241075 TGTCACTGTACTCCAGTCTGCGG - Intergenic
1056405154 9:86266832-86266854 TGTGCCTGTAATCCTGTGGGAGG - Intronic
1058989183 9:110238723-110238745 TTCCACTGTAACCCAGTGGGGGG + Intergenic
1059092835 9:111379141-111379163 CATGACTGTAATACAGTGGCAGG - Intronic
1059945743 9:119406637-119406659 TGTCACTGTACTCCAGTGTGGGG - Intergenic
1062183069 9:135201335-135201357 TGTGACTGTGATCCAGTGTGCGG + Intergenic
1186438685 X:9566223-9566245 TGCCACTGGCATCCAGTGGGTGG - Intronic
1186638894 X:11434099-11434121 TGTCACTTGCATCCAGTGGGTGG + Intronic
1194151098 X:90325869-90325891 TGTCACTCTGACAAAGTGGGTGG + Intergenic
1196665710 X:118313959-118313981 TGACAATTTAAAACAGTGGGGGG + Intergenic
1200497466 Y:3902623-3902645 TGTCACTCTGAAAAAGTGGGTGG + Intergenic