ID: 1078557330

View in Genome Browser
Species Human (GRCh38)
Location 11:12340051-12340073
Sequence TCTGGAAGGTAGAGCCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 527
Summary {0: 1, 1: 1, 2: 2, 3: 78, 4: 445}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078557330_1078557333 -2 Left 1078557330 11:12340051-12340073 CCATCTTGGCTCTACCTTCCAGA 0: 1
1: 1
2: 2
3: 78
4: 445
Right 1078557333 11:12340072-12340094 GAATATTTTCAATCCACAGTTGG 0: 4
1: 39
2: 160
3: 388
4: 855
1078557330_1078557334 10 Left 1078557330 11:12340051-12340073 CCATCTTGGCTCTACCTTCCAGA 0: 1
1: 1
2: 2
3: 78
4: 445
Right 1078557334 11:12340084-12340106 TCCACAGTTGGTTGAATCTGAGG 0: 8
1: 32
2: 100
3: 211
4: 522

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078557330 Original CRISPR TCTGGAAGGTAGAGCCAAGA TGG (reversed) Intronic
901079979 1:6578631-6578653 TCTGAAAGGGAAGGCCAAGAAGG - Exonic
902548258 1:17203991-17204013 TCTTGAAGGTAGAGCCGATGAGG - Intergenic
902571935 1:17352574-17352596 TCTGGAAGGCAGAGCCAGCAGGG + Intronic
902863579 1:19262729-19262751 TCTGGGAGGTAGAGGCTACAGGG + Intergenic
903020831 1:20392878-20392900 TCTGAAAGGTGGAGAGAAGAAGG + Intergenic
903039727 1:20520083-20520105 CCTGGAGGTTAGAGGCAAGATGG + Intergenic
903369901 1:22828473-22828495 TCTGGCAGGAAGAGGCCAGAGGG + Intronic
903888510 1:26554987-26555009 TCTGGTTGGCAGAGGCAAGAGGG + Intronic
904705561 1:32387913-32387935 TCGGGATGGTAGAACCAAGAAGG - Intronic
905007458 1:34721333-34721355 GCTGGAAGGCAGAGGCTAGAGGG - Intronic
905269680 1:36779336-36779358 GTTGGAAGTTAGAGCCTAGATGG - Intergenic
906021176 1:42631103-42631125 TCTGGAAGGTCTTCCCAAGAAGG - Intronic
906092926 1:43198095-43198117 GCTGGAAGGTAAAGTCAGGAGGG - Intronic
906282907 1:44566255-44566277 ACTGGAAGGTCGACCCCAGAGGG - Intronic
906374519 1:45284559-45284581 ACTGGTTGGTGGAGCCAAGATGG + Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
906760207 1:48369911-48369933 TTTTGAGGGTGGAGCCAAGATGG - Intronic
906850104 1:49238938-49238960 TCTGAAAGGTGGAGAAAAGAGGG - Intronic
907547363 1:55273917-55273939 TCTGAAAGGTGGAGTGAAGAAGG - Intergenic
907699083 1:56765785-56765807 TCTGAAAGGTAGAGAGAAGAAGG - Intronic
907926304 1:58958125-58958147 ATTGGAAGGAGGAGCCAAGATGG + Intergenic
909316227 1:74223218-74223240 TCCTGAAGCTAGAGCCTAGAAGG - Intronic
910022658 1:82611089-82611111 ACTGTAAGGTAGAGAGAAGAGGG - Intergenic
910412428 1:86961450-86961472 TGTGGAAGGGAGAATCAAGAAGG + Intronic
910992842 1:93073676-93073698 TTTGGAAGGTTGAGGCAAAAGGG - Intergenic
911674011 1:100638372-100638394 TCTGGAGGGAGGAGCCAAGATGG - Intergenic
911938500 1:104011543-104011565 TCTGGAAGCTTCATCCAAGAGGG + Intergenic
912175811 1:107154700-107154722 TCTGGCAGATATAGCCAGGATGG + Intronic
912506264 1:110158629-110158651 TCTAGAAGGTAAAACCAAGAGGG + Intronic
912861427 1:113217189-113217211 GCAGGAAGACAGAGCCAAGAGGG - Intergenic
913040756 1:115020174-115020196 TGTGGCAGGAGGAGCCAAGATGG - Intergenic
913931369 1:124967849-124967871 TCTGGGGGGAGGAGCCAAGATGG - Intergenic
914391964 1:147232061-147232083 TCTGGGGGGTGGAGCCAAGATGG - Intronic
914408420 1:147400791-147400813 TCTGAAAGGTGGAGTGAAGAAGG - Intergenic
914930089 1:151923156-151923178 CTTGGAGGGTAGAGGCAAGATGG + Intergenic
915100191 1:153493597-153493619 TGTGGAAGGTAGAGGGCAGAAGG - Intergenic
916945240 1:169719703-169719725 TCTGGAAGGTAAAGGCAAGATGG - Intronic
917919852 1:179742747-179742769 TCTGGCAGGAAGAGGCAGGAAGG - Intergenic
918518099 1:185384721-185384743 AATGGGAGGTGGAGCCAAGATGG - Intergenic
918654324 1:187005282-187005304 CTTGGAAGTTAGACCCAAGATGG + Intergenic
918990910 1:191696136-191696158 CTTGGAAGGTAGAAGCAAGATGG - Intergenic
919350526 1:196447618-196447640 TTTGGGAGGTAGAGCCAATAGGG + Intronic
920890402 1:209979335-209979357 TCTATCAGGTGGAGCCAAGATGG - Intronic
921226962 1:213030183-213030205 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
922009698 1:221570296-221570318 TCTGGAAGGGAGAAGCAAGGTGG + Intergenic
922824163 1:228505669-228505691 GGTGGGAGGTGGAGCCAAGATGG + Intergenic
923135066 1:231110216-231110238 TCTGAAAGGTAGAAAGAAGAAGG + Intergenic
923359250 1:233191881-233191903 TGTAGAAGTTAGAGCCAAGAGGG + Intronic
924285383 1:242481070-242481092 TCTGGGGGTTGGAGCCAAGATGG + Intronic
924547571 1:245044640-245044662 CCCGGGAGGTAGAGCCGAGATGG - Intronic
1063565516 10:7170126-7170148 TCTGGAAGGTGGAGAAAGGAGGG + Intronic
1064923666 10:20546719-20546741 ACTGGAAGGTAGGGCTAAGAAGG - Intergenic
1066562817 10:36689170-36689192 TCTGGAAGGTGGGGAGAAGAAGG + Intergenic
1066699664 10:38113587-38113609 TCTGGAAATTAGAACCAGGAGGG - Intronic
1067192158 10:44080723-44080745 TCTGAAAGGTACAGAGAAGAAGG - Intergenic
1068495413 10:57779611-57779633 TCTGGAAGCTTCATCCAAGAGGG - Intergenic
1068656285 10:59579265-59579287 TCTGAAAGGTGGAGAGAAGAAGG - Intergenic
1068871251 10:61947763-61947785 TCTAGCAGGAATAGCCAAGATGG - Intronic
1069647055 10:70008066-70008088 TCTGGGGGGTGGAGGCAAGAAGG - Intergenic
1069727412 10:70589706-70589728 TCTGGAGGTTAAAGGCAAGATGG + Intergenic
1070194674 10:74146205-74146227 TATGGAAGGTGGAGGGAAGAGGG + Intronic
1070571006 10:77638924-77638946 GCTGGAGGGTAGAGTCAGGAAGG + Intergenic
1070571119 10:77639584-77639606 TCTGGAAGGAAGAGCGAGCAAGG + Intergenic
1071407741 10:85355503-85355525 TGTGGGAGGAGGAGCCAAGATGG + Intergenic
1071473517 10:86004879-86004901 TCTGGAATCTTGAGACAAGAAGG + Intronic
1071858581 10:89649922-89649944 TTTGGAGGGTAAAGGCAAGATGG + Intergenic
1071941902 10:90599927-90599949 TCTGGAAGGCAGAGCAAAACTGG + Intergenic
1072055308 10:91749612-91749634 TTTGGAGGGCGGAGCCAAGATGG + Intergenic
1072120478 10:92401682-92401704 TTTGGAAGTTAGAAGCAAGATGG - Intergenic
1072981065 10:100097971-100097993 TCAAGAAGGCAGAACCAAGAGGG - Intergenic
1073168148 10:101476684-101476706 TTTGGGAGGTAGAGGCAGGAGGG - Intronic
1073591761 10:104764615-104764637 TCTAGATGCTTGAGCCAAGAAGG + Intronic
1073667486 10:105550200-105550222 GCTGGGAGGAGGAGCCAAGATGG + Intergenic
1073969641 10:109032634-109032656 TCTGGAGTGTAGAGGCAAGATGG - Intergenic
1074412593 10:113241368-113241390 TCTGGAAGACAGAGCCCGGAGGG + Intergenic
1074905711 10:117861786-117861808 TCTCGAAGATAGTACCAAGAGGG + Intergenic
1075478633 10:122759301-122759323 TCAAGAAGGTAGAGGAAAGATGG - Intergenic
1076005029 10:126941970-126941992 TGAGGAGGGGAGAGCCAAGAGGG + Intronic
1077946369 11:6904585-6904607 TTTGGAGGGTGGAGCCAAGATGG + Intergenic
1078473681 11:11612097-11612119 GATGGGTGGTAGAGCCAAGAAGG - Intronic
1078557330 11:12340051-12340073 TCTGGAAGGTAGAGCCAAGATGG - Intronic
1078674856 11:13400677-13400699 TCTGGGGGGTGGAGCCAAGATGG - Intronic
1078827205 11:14940570-14940592 TCTGGAAGCTGGAGCCCAGGTGG + Intronic
1079238901 11:18708616-18708638 TTTGGAGGGTAAAGGCAAGATGG - Intronic
1080032735 11:27679002-27679024 TCTGGATAGTAGTGCCAAGTGGG - Intronic
1080931082 11:36811777-36811799 TCTGGAAGGCACAACAAAGAAGG + Intergenic
1081102448 11:39022144-39022166 TCTGCAAAGGAGAGCCAAGGGGG - Intergenic
1081300143 11:41441302-41441324 GGTGGAAGGTAGAGGCAAAATGG + Intronic
1081382718 11:42435268-42435290 TATGGAGGGAGGAGCCAAGATGG - Intergenic
1081433863 11:43005500-43005522 TTTGGAAGGTAGAGCCAAGATGG - Intergenic
1081500271 11:43659523-43659545 ACTGGGGGGTGGAGCCAAGATGG - Intronic
1081802401 11:45869167-45869189 TCTAGAAGGTGGAGCCAAACAGG + Intronic
1083097333 11:60265068-60265090 TCTGGAGGGTAGGGCCAAGTTGG + Intergenic
1083523107 11:63334260-63334282 ATTGGAGGGTGGAGCCAAGATGG - Intronic
1083650021 11:64197592-64197614 TCTGGAAGGTTGAGCCTACTTGG - Exonic
1083882535 11:65555595-65555617 TCTGGAAGGCAGGGCCAGGCTGG + Intronic
1085879440 11:80448541-80448563 TTTGGAAGTTAGAAGCAAGATGG - Intergenic
1085967109 11:81540403-81540425 TTTGGGGGGTGGAGCCAAGATGG - Intergenic
1086543322 11:87938844-87938866 TCTGAAAGGTAGAGAAAAGAAGG - Intergenic
1088117534 11:106329451-106329473 TTTTGAAGGTAGAGCCAGCAGGG + Intergenic
1088142214 11:106631244-106631266 TTTGTAATGTAGAGCCAAGACGG - Intergenic
1088300866 11:108356928-108356950 TCCGGGAGGAGGAGCCAAGATGG + Intronic
1089464110 11:118672978-118673000 TCTGGAAGTTAAAGGGAAGAGGG - Intronic
1090338397 11:125992016-125992038 TCTAGAACATAGAACCAAGAAGG + Intronic
1090573831 11:128078159-128078181 TTTGGGGGGTGGAGCCAAGATGG - Intergenic
1091342460 11:134826732-134826754 TCTAGAAGCTACAGCAAAGATGG + Intergenic
1091734837 12:2912293-2912315 TGTCTAAGTTAGAGCCAAGATGG + Intronic
1091963416 12:4718494-4718516 TCTGAAAGGTAGAGAGAACAGGG - Intronic
1095590063 12:43893054-43893076 TGTGGAAGGTAGAGCATGGAAGG + Intronic
1095743407 12:45631567-45631589 TGTGGGAGGTAGTGGCAAGAGGG - Intergenic
1096348995 12:50878468-50878490 CTTGGAAGGTTGAGGCAAGAAGG + Intronic
1096724299 12:53548738-53548760 TTTGGAAGGCTGAGGCAAGAGGG + Intronic
1096922496 12:55102265-55102287 TCTTGGAGGAGGAGCCAAGATGG - Intergenic
1098042447 12:66365830-66365852 CCTGTAAGGTTGAGGCAAGATGG + Intronic
1098375617 12:69810503-69810525 TCTGGAGGGTGGAGCCAAGATGG - Intronic
1098421788 12:70305301-70305323 TCATGAGGGTGGAGCCAAGATGG - Intronic
1098697143 12:73573189-73573211 TCTGGAAGCTTCATCCAAGAGGG - Intergenic
1099114537 12:78608479-78608501 TTGGGATGGTGGAGCCAAGATGG + Intergenic
1100057931 12:90536600-90536622 ACTGGAAGGAGGAGCCAAGATGG + Intergenic
1100742537 12:97609346-97609368 TAAGGAGGGTGGAGCCAAGATGG - Intergenic
1101069768 12:101062249-101062271 TCTGGAAGCTTGAGCCCAGAGGG + Intronic
1101854936 12:108434357-108434379 TCTGGAAGGTAGTTCCAGGATGG - Intergenic
1103070480 12:117937028-117937050 TCAGTAAGGTGGAACCAAGAGGG - Intronic
1104294135 12:127496239-127496261 CCTGTGAGGAAGAGCCAAGAAGG - Intergenic
1105338441 13:19496783-19496805 TCTCGGAGGAGGAGCCAAGATGG + Intronic
1105602753 13:21901820-21901842 TCTGAAAGGCACAGCCAAGAGGG - Intergenic
1105650262 13:22369660-22369682 TCTGAATGGTAGACCTAAGAAGG + Intergenic
1106186992 13:27418344-27418366 TGTGGAAGCCAAAGCCAAGAAGG + Intergenic
1107097070 13:36548445-36548467 TATGGCAGGTAGAGACAAGGTGG + Intergenic
1107258998 13:38468119-38468141 TCTGAAAGGTAGAGAGAAGATGG - Intergenic
1107489844 13:40870580-40870602 TCTAGGAGGAGGAGCCAAGATGG - Intergenic
1109156228 13:58913465-58913487 TCTGAAAGGTAGAAAGAAGAAGG + Intergenic
1109551120 13:63901929-63901951 ACAGGAAGCTCGAGCCAAGATGG + Intergenic
1109650871 13:65324188-65324210 TCTTGAAGGAAGAGCAAAAAAGG + Intergenic
1110344109 13:74426317-74426339 TTAGGAATGTGGAGCCAAGATGG + Intergenic
1110566809 13:76965477-76965499 CATGGAAGGAAGAGACAAGAGGG - Intergenic
1112370606 13:98789832-98789854 CCTGGAAGGTGGAGTGAAGAAGG - Intergenic
1113935702 13:113994552-113994574 TCTGGGAGGCCGAGGCAAGAAGG + Intronic
1114807840 14:25857982-25858004 TATGGAGGGTGGAACCAAGATGG - Intergenic
1115868340 14:37772813-37772835 TTTGGAGGGAGGAGCCAAGATGG - Intronic
1116126560 14:40796073-40796095 TCTGGAGGTTAGAGCTAAGGTGG + Intergenic
1116292539 14:43062331-43062353 TTTGGAGGGAGGAGCCAAGATGG + Intergenic
1116541040 14:46101530-46101552 TGAGGAGGGTGGAGCCAAGAAGG - Intergenic
1116649918 14:47576991-47577013 TTTGGGAGGCAGAGGCAAGAGGG - Intronic
1118053231 14:62051601-62051623 ACAGGGAGGTGGAGCCAAGATGG - Intronic
1118484492 14:66200993-66201015 TGGGGAAGGTGGAGCCAAGATGG + Intergenic
1118487629 14:66228835-66228857 TCTGGAGGTTAAAGGCAAGATGG + Intergenic
1119397043 14:74334181-74334203 CCTGGAAGCCAAAGCCAAGAAGG + Intronic
1119762422 14:77161045-77161067 TCTGGGAGGTTGAGCTGAGAGGG - Intronic
1120486720 14:85123526-85123548 TTTGGGAGGTTGAGGCAAGAGGG - Intergenic
1120714874 14:87829914-87829936 TCTGGAAGCTGGAGAAAAGAAGG - Intergenic
1120732956 14:88023366-88023388 TCTGGAAGGTAATGTCAGGAAGG + Intergenic
1121031116 14:90659543-90659565 TCTGGAAAGGAGGGCGAAGAAGG + Intronic
1123887589 15:24742168-24742190 TTTGGAATGTAGAAGCAAGAGGG - Intergenic
1125988926 15:44086026-44086048 TTTAAAAGGTAGAACCAAGAGGG + Intronic
1126482906 15:49146612-49146634 TTTTGAAGGTAGAGTCAATAAGG - Intronic
1127166884 15:56252983-56253005 TCTGGAAGGTAGAGAGGAGAAGG + Intronic
1128303826 15:66584795-66584817 TCTGGTAGCTTGAGCCTAGAGGG - Intronic
1128827130 15:70729650-70729672 TGTGGAGGGAGGAGCCAAGATGG + Intronic
1130392845 15:83473997-83474019 TCTGAAAGGTGGAGAGAAGAAGG - Intronic
1130432282 15:83860677-83860699 TGAGGGAGGTGGAGCCAAGATGG + Intronic
1130733857 15:86528091-86528113 TCTGGGGGGAGGAGCCAAGATGG + Intronic
1130810854 15:87377225-87377247 TATGGAGGGTGGTGCCAAGATGG + Intergenic
1130976367 15:88778633-88778655 CCTGCAGGGTTGAGCCAAGAGGG + Intergenic
1130998339 15:88917989-88918011 TCTTCAGGGTTGAGCCAAGAAGG + Intergenic
1131090040 15:89617113-89617135 TCTGAAAGGCAGAGAGAAGAAGG - Intronic
1131528774 15:93174303-93174325 TCTTGAAGGTGGAGCCTAGTAGG - Intergenic
1131595289 15:93792216-93792238 TGTGGAGGGTGGAGCCAAGATGG + Intergenic
1132326751 15:100977036-100977058 TCTAAAAGGTAGAGAAAAGAAGG + Intronic
1133206174 16:4235101-4235123 TAGGGAAGGGAGACCCAAGAGGG + Intronic
1134022708 16:10932364-10932386 TCTAGGAGGTAGGGCCAAGTAGG + Intronic
1134172964 16:11983314-11983336 TTTGGAAGGTTGAGACAGGATGG - Intronic
1134255085 16:12603809-12603831 TCTGGGGGGAGGAGCCAAGATGG + Intergenic
1134801845 16:17091753-17091775 TCTGGAAGGTAGAGCTGGGCGGG + Intergenic
1135973472 16:27089320-27089342 TCTGAAGGGTAGAGAGAAGAAGG + Intergenic
1135998728 16:27273436-27273458 CCTGGGAGGTAGAGCCCAGGAGG + Intronic
1136372921 16:29847431-29847453 CCAGGAAGGCAGAGCCAAGGCGG + Intronic
1137065554 16:35838438-35838460 TCTGAAAGGCAGAGGCAGGATGG + Intergenic
1138280897 16:55771477-55771499 TTCTGAAGGTGGAGCCAAGAGGG - Intergenic
1138785144 16:59836831-59836853 GCTGGGGGGTGGAGCCAAGATGG - Intergenic
1139245858 16:65442972-65442994 TCTGGAAGTGAGAGTAAAGATGG - Intergenic
1140095099 16:71868357-71868379 TTGGGAAGATAGAGGCAAGAAGG + Intronic
1140134153 16:72190349-72190371 TCGTGAAGCTAGAGGCAAGATGG + Intergenic
1141154476 16:81587661-81587683 TCTGGAAGATGGAGCAGAGACGG - Intronic
1141426744 16:83949273-83949295 TCTGGAGGGGAGACCCAGGAAGG - Exonic
1143288051 17:5805908-5805930 TCTGAAAGGTGGAGAGAAGAAGG - Intronic
1143586042 17:7850999-7851021 TCTGGAAGGGAGGGCCGAGCAGG - Exonic
1143932023 17:10438831-10438853 TCTGGAAGATGGAGAAAAGATGG - Intergenic
1144337569 17:14285431-14285453 TATGGAAGGTGGAGGGAAGAAGG + Intergenic
1144443083 17:15301490-15301512 TCTGGAAGGTTGAGTTGAGAAGG - Intergenic
1145015931 17:19398170-19398192 TCTGAAAGGTGGAGAAAAGAAGG - Intergenic
1146739872 17:35274367-35274389 TCTCGGGGGTGGAGCCAAGATGG + Intergenic
1147166038 17:38593937-38593959 TCTGGCTGGTAAAGCCAGGACGG + Intronic
1148406156 17:47418306-47418328 TCTGGAAAATAGTGCCAAAAAGG - Intronic
1150728547 17:67671344-67671366 TCTGGAATGTAGAGACAATTTGG - Intronic
1151070988 17:71211504-71211526 TCTGAAAGGTAGAGAGAAAAAGG + Intergenic
1151241068 17:72758268-72758290 TCTGGAAGACACAGTCAAGAAGG + Intronic
1151301721 17:73232022-73232044 TCTGGGAGATAGAGCCGAGGGGG - Intronic
1151320312 17:73348846-73348868 CCTGGAAGGCAGACCCAGGAAGG - Intronic
1151517794 17:74607611-74607633 TGTGGAAGGCAGAGCCATGGAGG + Intergenic
1153726929 18:7966439-7966461 TCTAGAAGGAGGAGCCAAGATGG + Intronic
1153923141 18:9808831-9808853 TCTGGGAGGCAGAGCCCAGCTGG + Intronic
1154005184 18:10521277-10521299 TCTGGGAGGCTGAGGCAAGAGGG + Intergenic
1154981401 18:21505316-21505338 TATGGGACGTAGAGCCCAGATGG - Intronic
1155497683 18:26458781-26458803 TCTGGAGGGTAGAGCTAATAAGG - Intronic
1155597899 18:27510005-27510027 TTTAGAAGGAGGAGCCAAGATGG + Intergenic
1157494083 18:48142827-48142849 ACAGGAAGGAAGAGTCAAGAAGG - Intronic
1157762268 18:50273743-50273765 GCTTCAAGGTAGGGCCAAGATGG + Exonic
1157933485 18:51848804-51848826 TTTGGAAGATAGAGTCAATAGGG - Intergenic
1159842611 18:73417022-73417044 TCTGAAAGGTAGAAACAAGAAGG + Intergenic
1160178814 18:76617271-76617293 TCTGGAAGGGAGAGGGAAAATGG - Intergenic
1162492005 19:10998265-10998287 TCTGGCAGGCAGACCCAACATGG + Intronic
1162537724 19:11273516-11273538 TCTGAAAGGTTGTGCTAAGAAGG - Intergenic
1162792148 19:13068731-13068753 TCTGGAAGGGAGGGCTACGAAGG - Intronic
1163972022 19:20807719-20807741 TATGGGGGGTGGAGCCAAGATGG + Intronic
1164429831 19:28177579-28177601 TTTGGAGGGAGGAGCCAAGATGG + Intergenic
1164523004 19:28992968-28992990 TTTGGAGGGTAGAAGCAAGATGG - Intergenic
1167403985 19:49291982-49292004 TCTGGAAGGTAGAGCTACCTGGG - Intronic
1167426602 19:49432796-49432818 TCAGCAAGGTAGAGCCCAGGAGG - Exonic
1168438648 19:56344113-56344135 TGTGGAGGTTAGAGTCAAGATGG - Intronic
925963197 2:9038325-9038347 TTGGGTAGGTGGAGCCAAGATGG + Intergenic
929353437 2:40990150-40990172 TTTGGAAGTTAGAAGCAAGATGG - Intergenic
929459362 2:42090746-42090768 TCTGGCAGGTAGAGACTTGAAGG + Intergenic
929620618 2:43350529-43350551 TGTGGAAGTCAGAGGCAAGAGGG - Intronic
929929620 2:46242599-46242621 TCTGAAAGGCAGAGCCAAATGGG - Intergenic
930175974 2:48302308-48302330 TCTGGAAGCTTCATCCAAGAGGG + Intergenic
931111983 2:59120783-59120805 TGTTGAAGGTAGAGCCTAGTGGG + Intergenic
931449418 2:62355777-62355799 TTTGGAGGTTAGAACCAAGATGG + Intergenic
931574873 2:63708751-63708773 CCAGGAGGGTGGAGCCAAGATGG - Intronic
931971306 2:67589685-67589707 TCTGGAAGTTTGATCCCAGAGGG - Intergenic
932797288 2:74707744-74707766 TCAGGAAGGTGGAACCCAGATGG + Intergenic
932913967 2:75834765-75834787 TCTGGAAGCTTCAACCAAGAGGG - Intergenic
933669242 2:84991128-84991150 TCTTGAAGGTAGAGACAATGAGG + Intronic
933730457 2:85452339-85452361 TTTTGAAGGTAGAGCCAACAGGG - Intergenic
933991182 2:87634897-87634919 TCTGGCTGGTAGAGGCAGGAGGG + Intergenic
934124271 2:88871285-88871307 TCTGGAAGCTGGAGAGAAGAAGG + Intergenic
935658034 2:105441573-105441595 TCTCTAGGGTAGATCCAAGAGGG + Intergenic
936302657 2:111315926-111315948 TCTGGCTGGTAGAGGCAGGAGGG - Intergenic
936372864 2:111917545-111917567 TCTGAAAGGTAGAGAGAAGCAGG - Intronic
936891077 2:117370915-117370937 TTTGGAGGTTAGAGGCAAGATGG + Intergenic
936929944 2:117778175-117778197 TTTGGGAGGAGGAGCCAAGATGG + Intergenic
937052209 2:118901774-118901796 GCCGGAAGGAGGAGCCAAGATGG - Intergenic
937256687 2:120560858-120560880 TCTGGAAGGCAAAGGCTAGAGGG + Intergenic
937847575 2:126598542-126598564 TCCGGTAGGTAGTGCCTAGATGG - Intergenic
938060917 2:128253611-128253633 TCTGAAAGGTGGAGAGAAGACGG + Intronic
938231202 2:129660712-129660734 TGTGAAAGGTAGAGAGAAGAAGG - Intergenic
939502572 2:143006039-143006061 ACTGGAGGGAGGAGCCAAGATGG + Intronic
940055359 2:149507388-149507410 TGTGGGGGGTAGAGCCAAGATGG - Intergenic
940853905 2:158714964-158714986 TCTGAAAGGTAGAGGGAAGAAGG - Intergenic
940898957 2:159108796-159108818 TCTAGAAGGGAGAGCCCAGTGGG + Intronic
941094219 2:161217381-161217403 TCTGGCTGGAAGAACCAAGAAGG - Intronic
942062269 2:172238841-172238863 CACGGAAGGTAGAACCAAGATGG + Intergenic
942186897 2:173432732-173432754 TCTAGAAGATAAAGCCCAGAAGG - Intergenic
942500091 2:176580112-176580134 TCTGGAGTGTAGAGTCAAAAGGG + Intergenic
943255831 2:185591890-185591912 CCTAGAAGGAGGAGCCAAGATGG - Intergenic
943652347 2:190471101-190471123 ACAGGAGGGTGGAGCCAAGATGG + Intronic
943815489 2:192249234-192249256 TTTGGAAGGTAGAGGGAACACGG - Intergenic
943934913 2:193903871-193903893 CCTTGGAGGTGGAGCCAAGATGG + Intergenic
943956767 2:194201695-194201717 TCTGGAAGGTATAATCAGGATGG - Intergenic
944018575 2:195073525-195073547 CCTGGAGGGAGGAGCCAAGATGG - Intergenic
944529046 2:200649687-200649709 TCTGGGAGGAGGAGCCAGGAAGG - Intronic
944613815 2:201439640-201439662 TCTGGGTGGTGTAGCCAAGATGG + Intronic
945169013 2:206976390-206976412 TTTGGAAGTTAAAGGCAAGATGG + Intergenic
945348907 2:208752627-208752649 TTTTGAAGGAGGAGCCAAGATGG - Intronic
945870379 2:215220240-215220262 CTTGGAAGGAGGAGCCAAGATGG + Intergenic
946436985 2:219663716-219663738 CCAGGAAGGAAGAGCCATGAAGG - Intergenic
946659494 2:221984559-221984581 TTCGGAAGGAGGAGCCAAGATGG + Intergenic
947869272 2:233423940-233423962 CCTGAAAGGTAGAGAGAAGATGG - Intronic
948454029 2:238096436-238096458 TCTGGATGGTAGAGACACGTGGG - Intronic
948662972 2:239518120-239518142 TCGTGAAGGTAGAGGCATGATGG - Intergenic
948927794 2:241110591-241110613 TCTGGGAGGCAGGGCCAAGGTGG + Intronic
1168758491 20:332393-332415 TTTTGAAGGTAGAGCCAACAGGG - Intergenic
1170084199 20:12510791-12510813 TCTGGAAGCTAGAATCAAGCTGG + Intergenic
1171027077 20:21640590-21640612 GCAGGAAGACAGAGCCAAGATGG + Intergenic
1171404472 20:24900599-24900621 ACTGCAAGGAGGAGCCAAGATGG + Intergenic
1171457161 20:25278608-25278630 TCTGGAAGGGAGGGCCCAGGTGG - Intronic
1171463074 20:25309681-25309703 TCTGGAAGGGTGGGCCAAGCGGG - Intronic
1173853689 20:46235700-46235722 CATTGAAGGTAGAGCCAACAGGG - Intronic
1174830680 20:53809325-53809347 TCTCAAAGGTAGAACCTAGAAGG - Intergenic
1177549437 21:22600986-22601008 CTTGGAAGGTAGAAGCAAGATGG - Intergenic
1178044338 21:28676908-28676930 TCTTTAAGATGGAGCCAAGATGG + Intergenic
1178925011 21:36767424-36767446 TCAGGAATGTGGAGCCATGAGGG + Intronic
1179228459 21:39477680-39477702 TCTGGAAGGTACAGTGAAGCTGG - Intronic
1179257089 21:39726521-39726543 TGTGGATGGAGGAGCCAAGATGG + Intergenic
1179497678 21:41784093-41784115 TCTGGAAGATAGGGGCAGGACGG - Intergenic
1180164618 21:46017731-46017753 TCTGAAAGGTGGAGCAAAGAAGG - Intergenic
1181800518 22:25344971-25344993 TATGGGAGGTGGAGCCAAGATGG - Intergenic
1183410668 22:37653498-37653520 CCTGGTAGGTAGGGCCAGGATGG - Intronic
1184484877 22:44770965-44770987 TTTGGAAGTTAAAGGCAAGATGG + Intronic
1184655590 22:45940529-45940551 TCTGGGAGGTCCAGCCAGGAGGG - Intronic
1184756253 22:46517468-46517490 TCTGGAGGGTAGAACCACAATGG + Intronic
1185000425 22:48242164-48242186 CCTGGAAAGGAGAGCCCAGATGG + Intergenic
949527198 3:4916531-4916553 TCTCGGAGGAGGAGCCAAGATGG + Intergenic
950250289 3:11459582-11459604 CCTGGAAGCCAGAGCCAACAGGG + Intronic
950718686 3:14867479-14867501 TCTGAAGGGTAGATCCCAGAAGG + Intronic
951419364 3:22466040-22466062 TCTGGAAGGCATAGCTGAGATGG + Intergenic
951789538 3:26464798-26464820 TCTGGAAGCTTCATCCAAGAGGG - Intergenic
953107139 3:39894292-39894314 TCTGGAAGGCAGTGGCTAGATGG - Intronic
953154189 3:40353981-40354003 TTTTGGAGGTAGAGCCAATAGGG - Intergenic
953236855 3:41114432-41114454 TTTGGAAGGCAGAGACAGGAAGG + Intergenic
954907630 3:54076397-54076419 TATGCAAGGCAGAGGCAAGAGGG - Intergenic
955478214 3:59360930-59360952 GCAGAAGGGTAGAGCCAAGACGG - Intergenic
955666559 3:61355425-61355447 ACTGAAAGGTAGAGAAAAGAAGG - Intergenic
956423682 3:69111043-69111065 TCTGGAAGGTACATACATGATGG - Intronic
956477340 3:69636708-69636730 TCTGGAAGCTTCATCCAAGAGGG + Intergenic
957018598 3:75097996-75098018 ACTGGGAGGAGGAGCCAAGATGG - Intergenic
957344502 3:78944523-78944545 TGTGGAGGGAGGAGCCAAGATGG + Intronic
957798969 3:85049972-85049994 TCAAGAAGGTGGAGTCAAGAAGG - Intronic
958410419 3:93808597-93808619 AATGGAGGGTGGAGCCAAGATGG - Intergenic
958495171 3:94836018-94836040 TTTCAAGGGTAGAGCCAAGATGG + Intergenic
958749071 3:98174080-98174102 TCAGGGAGGTGGAGCCAAGATGG + Intronic
962397681 3:135031231-135031253 TCTTGAGGGAGGAGCCAAGAGGG - Intronic
963196123 3:142532230-142532252 ACTGGGAGGTGGAGCCAAGATGG - Intronic
963372536 3:144419546-144419568 TCTGTAAGATGGAGGCAAGAGGG - Intergenic
964763444 3:160156129-160156151 TTTGGTAGTTAGAGCTAAGAAGG - Intergenic
965284732 3:166804780-166804802 TCTGGTGAGAAGAGCCAAGATGG + Intergenic
966358924 3:179112948-179112970 TTTGGAAGGTGGAAACAAGATGG + Intergenic
966855830 3:184193343-184193365 GCTGGAAGGCAGAACCAGGAAGG - Exonic
967224146 3:187275000-187275022 TCTGGGAGGGAGAGCCAGGGAGG + Intronic
967394116 3:188987680-188987702 TCTGAAAGGCAGAGAGAAGAAGG - Intronic
969037759 4:4269129-4269151 TCTGAAAGGTAGAGACCAGCTGG + Intronic
971054013 4:22892281-22892303 TCTGCGGGGTGGAGCCAAGATGG - Intergenic
971142391 4:23938289-23938311 CCTGGAAGGTAGAGGCACCAAGG + Intergenic
971623496 4:28887411-28887433 ACTGGAAGTTAGAAGCAAGATGG + Intergenic
972129844 4:35819026-35819048 TTTTGAAGGTAGAGCTAACAAGG - Intergenic
972150002 4:36077556-36077578 TTTTGAAGGTAGAGCCAATAAGG - Intronic
972196238 4:36656781-36656803 TCTGGAAGCTTCACCCAAGAGGG - Intergenic
972898514 4:43654347-43654369 TTTAGAGGGTGGAGCCAAGATGG + Intergenic
973865789 4:55111466-55111488 TTTTGAAGGTAGAGTCAACAGGG - Intronic
974114972 4:57568329-57568351 TCCGGGAGGAGGAGCCAAGATGG - Intergenic
974196703 4:58584934-58584956 TCTGGAAGGTTCATCCCAGAGGG + Intergenic
974427642 4:61760787-61760809 CTTGGAGGGTGGAGCCAAGATGG - Intronic
974463469 4:62221114-62221136 TCTGGAGGTTAGAGGCAAGATGG + Intergenic
976025859 4:80687671-80687693 TCTGGAGGGAGGAGGCAAGATGG + Intronic
978363187 4:107952560-107952582 TCTGGAAAACAGAGCAAAGAAGG - Exonic
978406494 4:108384883-108384905 TCTGAAAGGTGGAGACAAGAAGG + Intergenic
978659032 4:111100758-111100780 TCTTGGAGGTGGAGCCAAGATGG - Intergenic
978736120 4:112086460-112086482 TCTTGGAGGAGGAGCCAAGATGG + Intergenic
978782821 4:112575287-112575309 TTTGGGGGGAAGAGCCAAGATGG + Intronic
979299274 4:119068047-119068069 TGTGATAGGTGGAGCCAAGATGG - Intergenic
979592120 4:122492912-122492934 ACTGGAGGGTGGAGCCAAGATGG + Intergenic
981352706 4:143751746-143751768 TTTGGAGGGTAGGGCCAAGACGG + Intergenic
982689646 4:158533241-158533263 TTTGGAATTTAAAGCCAAGAAGG + Intronic
983704270 4:170639222-170639244 TTTCGAGGGTGGAGCCAAGATGG + Intergenic
984956301 4:185049421-185049443 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
987222164 5:15802105-15802127 TTTTGGAGGTAGAGCCAAGTGGG - Intronic
987561652 5:19531086-19531108 TATTGGAGGTGGAGCCAAGATGG - Intronic
987985855 5:25144711-25144733 TCTAGAAGGTTGAGACTAGAAGG - Intergenic
988407440 5:30841587-30841609 TCTGGTAGGTAAAGCCATGTGGG + Intergenic
988554535 5:32224753-32224775 TGTGGAAGGTGGACCCAATAAGG + Intergenic
989407670 5:41079410-41079432 TCAGGGGGGTGGAGCCAAGATGG - Intergenic
989679639 5:44013802-44013824 TTTTGGAGGTGGAGCCAAGATGG + Intergenic
989953508 5:50330066-50330088 TTTAGAGGGTAGAGCCAAGATGG + Intergenic
990678555 5:58215906-58215928 TCAGGAGGTTGGAGCCAAGATGG + Intergenic
992028502 5:72696110-72696132 TCTGGGAGGAAGAGAGAAGAGGG + Intergenic
992576395 5:78118195-78118217 CCAGGAGGGTGGAGCCAAGATGG + Intronic
992761318 5:79953142-79953164 TCTGGGAGGAAGAGAAAAGAAGG - Intergenic
993474346 5:88345952-88345974 TTTGGAAGGTGGAGAGAAGAAGG - Intergenic
994160830 5:96555237-96555259 TTCGGAGGGTGGAGCCAAGATGG + Intronic
994983478 5:106905170-106905192 AATGGAAGGAGGAGCCAAGATGG - Intergenic
995145773 5:108785896-108785918 TCTGGAAGGTGGAAAGAAGAAGG - Intronic
996254386 5:121380410-121380432 ACTGGAAGGTAGGGGAAAGAAGG + Intergenic
996455927 5:123680687-123680709 TACGGAGGGTGGAGCCAAGATGG - Intergenic
997800171 5:136853118-136853140 TCTGGAAGGTTTATCCCAGAGGG + Intergenic
997808918 5:136947560-136947582 TGTGGGGGGTGGAGCCAAGATGG - Intergenic
997845593 5:137283194-137283216 ACTGGGAGGTAGAGGCAAAAGGG - Intronic
998770259 5:145535685-145535707 TCTGAAAGTTGGAGCCAAAACGG - Intronic
999670704 5:153956968-153956990 TCGGGAAGGCAGAGACAAGAGGG - Intergenic
1001532071 5:172470243-172470265 TCTGGAAGGTGGAGAGAAGAAGG - Intergenic
1001600076 5:172922972-172922994 TTTGGAAGGTGGAGCTAACAGGG + Intronic
1001678056 5:173534862-173534884 TCTTGAAGGATGAGCCAAAAAGG - Intergenic
1002887496 6:1310343-1310365 TGGGGAAGGTAAAGCCAAGGAGG - Intergenic
1004392525 6:15221529-15221551 TGGGGAGGGAAGAGCCAAGAGGG + Intergenic
1006870193 6:37244254-37244276 TCTGGAGGTTAGAAGCAAGAAGG + Intronic
1008014081 6:46498390-46498412 TCTGACAAGTAGAGCAAAGAGGG - Intergenic
1008163066 6:48102472-48102494 TCTTGAGGGTGGAGCCAAGATGG + Intergenic
1008327697 6:50204511-50204533 ACTGGAATTTAGAACCAAGAAGG - Intergenic
1008576002 6:52860823-52860845 TTTGGGGGGTGGAGCCAAGATGG + Intronic
1008875276 6:56319263-56319285 TCTGGTAGGCAGAGTCAAGAGGG + Intronic
1009416216 6:63419185-63419207 TCTGGAAGGTAGAAATAAGAAGG - Intergenic
1009583655 6:65568908-65568930 TTTGGAAGTTAGAGGCAAGATGG - Intronic
1009678577 6:66860325-66860347 TCTGGAATGTAACTCCAAGAAGG + Intergenic
1010036417 6:71330758-71330780 TCTGGAAGCAGGAGCCAAGGTGG - Intergenic
1010280120 6:74013619-74013641 ACTCGGGGGTAGAGCCAAGATGG - Intergenic
1010603598 6:77862078-77862100 AATGGAGGGTGGAGCCAAGATGG + Intronic
1010869325 6:81018193-81018215 TTTTGAGGGTGGAGCCAAGATGG - Intergenic
1011296873 6:85835499-85835521 CCTGGGGGGTGGAGCCAAGATGG - Intergenic
1011306849 6:85936571-85936593 GCGGGAGGGTGGAGCCAAGATGG - Intergenic
1011488934 6:87871309-87871331 TTTGGAATGTTGAGCTAAGAGGG + Intergenic
1011533451 6:88350811-88350833 TCAGGGAGGATGAGCCAAGATGG + Intergenic
1011786973 6:90857867-90857889 TCTGAATTGGAGAGCCAAGAGGG + Intergenic
1012251615 6:96987002-96987024 ACTGGGGGGTGGAGCCAAGATGG - Intronic
1012338463 6:98089187-98089209 TCTGGAGGGGGGAGCCAAGATGG - Intergenic
1013169899 6:107627364-107627386 TCTGTAAGGCAGAGCAGAGATGG - Intronic
1013267381 6:108513124-108513146 TTTGTATGGTGGAGCCAAGATGG + Intronic
1014265908 6:119277577-119277599 TTTGGGAGGTAGAGGCAGGAGGG + Intronic
1014820209 6:125980955-125980977 TTTGGAAGGTACTGCCAACAAGG - Intergenic
1014960151 6:127673025-127673047 GAGGGAAGGTGGAGCCAAGAGGG - Intergenic
1016231747 6:141814811-141814833 TCTGGAGGGAGGAGCCAAGATGG + Intergenic
1016708614 6:147143282-147143304 TTGGGAAGGTAGAGGAAAGAAGG - Intergenic
1017334798 6:153243497-153243519 GATGGAAGGTAGAGCCTGGAAGG - Intergenic
1018179195 6:161205959-161205981 TCTGAAAGGTGGAGAGAAGAAGG + Intronic
1020537141 7:9413921-9413943 TCTGGGAGGTAGAGCACAGGAGG - Intergenic
1020600565 7:10270214-10270236 ACTGGAGGGTGGAGCCAAGATGG + Intergenic
1021520943 7:21538501-21538523 TCTGGAAGGTCCATCCCAGATGG + Intergenic
1021701190 7:23321055-23321077 TCGGGAGGGAGGAGCCAAGATGG + Intronic
1021938280 7:25653168-25653190 TCAGGAAGGTAGAGCCTAAAGGG - Intergenic
1023320138 7:38987924-38987946 TCTGGAAGGAAGAAACAAGAGGG - Intronic
1023437370 7:40152332-40152354 CCTGGAGGTTAGAACCAAGATGG + Intronic
1024892293 7:54218122-54218144 TATGGAGGGTGGAGCCAAGATGG + Intergenic
1026014520 7:66662546-66662568 GCTGGAAGGTAGAGACAGGCAGG + Intronic
1026079617 7:67205937-67205959 TCTCAAAGGTAGAGATAAGAAGG - Intronic
1026452571 7:70542399-70542421 TCTGGAAAGATGAGCCAAGGGGG - Intronic
1026488228 7:70838949-70838971 TCTGGAAGCTTCATCCAAGAGGG - Intergenic
1026697231 7:72606045-72606067 TCTCAAAGGTAGAGATAAGAAGG + Intronic
1027779331 7:82503162-82503184 TCTGAAAGGTAGAGAAAAAAAGG + Intergenic
1029044496 7:97613653-97613675 TGTGGGAGGAGGAGCCAAGATGG + Intergenic
1029059774 7:97785604-97785626 ATTGGAGGGTGGAGCCAAGATGG + Intergenic
1029087948 7:98025945-98025967 TTTGGGAGGAAGAGGCAAGAGGG + Intergenic
1029945914 7:104532657-104532679 TCTGGAAACAAAAGCCAAGAAGG + Intronic
1030122663 7:106125349-106125371 TCTGGCAGGAAGAGCAACGAAGG + Intergenic
1030457701 7:109794980-109795002 TGTGGGAGGTGGAGCCAAGATGG + Intergenic
1030637128 7:111963190-111963212 TCTAGGAGGAGGAGCCAAGATGG + Intronic
1030791618 7:113736920-113736942 TCTTAAAGGTAGAGAAAAGAGGG - Intergenic
1033121458 7:138670135-138670157 TTTGGAAGTTAAAGCCAAAATGG - Intronic
1034727465 7:153351026-153351048 TCTGAAAGGTAGAGGGGAGAAGG - Intergenic
1035935626 8:3834735-3834757 TCTCGGAGGTGGAGCCAAGATGG + Intronic
1036407814 8:8470856-8470878 TGTGGAGGGAGGAGCCAAGATGG + Intergenic
1037561123 8:20075198-20075220 TCTGGAAGTTAAAGGCAAGATGG + Intergenic
1038991003 8:32868305-32868327 TCTTGAAATTAGAGGCAAGAAGG - Intergenic
1039734991 8:40322238-40322260 TGTGGAAGGCAGAGCAGAGATGG + Intergenic
1039767570 8:40647058-40647080 TCTGGGGGGAGGAGCCAAGATGG + Intronic
1039972600 8:42333125-42333147 TCTGAAAGGTAGAGATAAGACGG + Intergenic
1040621676 8:49098971-49098993 TAAGGAAGGTAAAGCCAAGATGG - Intergenic
1041478695 8:58294567-58294589 TCTAGAAGGCTGAGGCAAGAGGG - Intergenic
1041634693 8:60130028-60130050 TCTGGAAGGTTCATCCCAGAGGG + Intergenic
1042455660 8:68999518-68999540 TCTGAAAGGTAGAGAGAAGAAGG - Intergenic
1042487073 8:69357416-69357438 CCTGGGAGGAGGAGCCAAGATGG - Intergenic
1042824662 8:72967893-72967915 TTTGGAAGGCAAAGCCAGGAGGG + Intergenic
1043272297 8:78350504-78350526 TTAGGGAGGTGGAGCCAAGATGG + Intergenic
1043373509 8:79621103-79621125 CATGGAAGGAAGAGCCCAGAAGG + Intronic
1043524779 8:81084148-81084170 TCTGAAAGGTAGAGGAAAGATGG - Intronic
1043791286 8:84470148-84470170 TTTGGAGGGAGGAGCCAAGATGG - Intronic
1044811725 8:96070413-96070435 TCTGGAGGGTGGTTCCAAGATGG + Intergenic
1045177203 8:99738834-99738856 TATCGAGGGTGGAGCCAAGATGG + Intronic
1045667609 8:104506485-104506507 TCTGGAATGTAGACCCAAGTAGG - Intronic
1045878955 8:107015163-107015185 TCTGGAGGTTAGGTCCAAGAAGG - Intergenic
1046602971 8:116339565-116339587 AGTGAAAGGTAGAGCAAAGATGG + Intergenic
1046829073 8:118723837-118723859 TCTGGTGGGAGGAGCCAAGATGG - Intergenic
1046973470 8:120248277-120248299 TGTGGGAGGTAGAGGCGAGAGGG - Intronic
1047360789 8:124167045-124167067 CCTGGAAGGTAGAGAGAAGATGG - Intergenic
1047594213 8:126360724-126360746 TCTGGAAGATAGAGAGGAGAAGG + Intergenic
1047639785 8:126805628-126805650 TCTGGAGGGAGGAGCCAAGATGG - Intergenic
1047936034 8:129779447-129779469 ACTGGAAGGTAGAGCATGGAGGG + Intronic
1048278719 8:133088953-133088975 TCTGGAAGCTAAAGCACAGATGG - Intronic
1049238579 8:141525176-141525198 TCTGGAAGGGGGAGCCAGTAGGG + Intergenic
1049240449 8:141535166-141535188 GCAGGAAGGAAGAGCCAGGAGGG + Intergenic
1050500747 9:6295352-6295374 GCTGGGAGGTGAAGCCAAGATGG + Intergenic
1050999361 9:12261122-12261144 TTTGGAAGGAAGAGCCAACAGGG - Intergenic
1051055300 9:12978188-12978210 CTTGGAAGGTAGAGAGAAGAGGG - Intergenic
1051209279 9:14724511-14724533 TTTGGGAGGCAGAGGCAAGATGG - Intergenic
1051454903 9:17244458-17244480 TTTGGAAGGCAGAGGCAGGAGGG - Intronic
1053611754 9:39721017-39721039 TCTGGAAGGTAGGGACAAGCAGG - Intergenic
1053869790 9:42479019-42479041 TCTGGAAGGTAGGGACAAGCAGG - Intergenic
1054086501 9:60750138-60750160 TCTGGAAGGTAGGGACAAGCAGG + Intergenic
1054241767 9:62621376-62621398 TCTGGAAGGTAGGGACAAGCAGG + Intergenic
1054555890 9:66655899-66655921 TCTGGAAGGTAGGGACAAGCAGG + Intergenic
1054770507 9:69078902-69078924 CATGGAAGGTACAGCCAAGCAGG - Intronic
1055613174 9:78043983-78044005 TTTGGAAAGTTGAGCCAAGAAGG - Intergenic
1056089192 9:83187736-83187758 AATGGAAGGTAGAGGGAAGAAGG - Intergenic
1056376864 9:86023151-86023173 CTTGGAAAGGAGAGCCAAGAGGG - Intergenic
1056861802 9:90192186-90192208 ACTGGGGGGTGGAGCCAAGATGG + Intergenic
1057747254 9:97762140-97762162 TCAGGTAGGTGGAGCCTAGAGGG + Intergenic
1058079915 9:100690710-100690732 TCTGGAGGGAGGAGCCAAGATGG + Intergenic
1058211470 9:102174631-102174653 TAAGGAGGGTGGAGCCAAGATGG - Intergenic
1058857608 9:109079282-109079304 TTAGGAAGGTGGAGCCAAAAAGG + Intronic
1061229075 9:129301952-129301974 TCTGAAAGGTAGAAAGAAGAAGG - Intergenic
1061409728 9:130413571-130413593 TCTGAAAAGTAGAGAAAAGAAGG + Intronic
1061634656 9:131899690-131899712 TCTCGATGGCAGAGCCAGGAGGG - Intronic
1061977023 9:134074060-134074082 TGTGGATGGCAAAGCCAAGATGG - Intergenic
1185952366 X:4451355-4451377 TCTGGGGGGCAGGGCCAAGACGG + Intergenic
1186062663 X:5726801-5726823 TCTGGAGGTTAGAAGCAAGATGG + Intergenic
1186165921 X:6825737-6825759 TCAGGATGGGAGAGACAAGAAGG - Intergenic
1186571000 X:10715056-10715078 TTGGGAGGGTGGAGCCAAGATGG + Intronic
1186589357 X:10913504-10913526 TCTGAAAGGTGGAGAAAAGAAGG - Intergenic
1186992873 X:15088418-15088440 TCTCGGGGGTGGAGCCAAGATGG + Intergenic
1187399015 X:18942919-18942941 GCTGGAAGATAGGGTCAAGATGG + Intronic
1187835621 X:23429427-23429449 TAAGGGAGGTGGAGCCAAGATGG - Intergenic
1188167805 X:26883882-26883904 TTTGGAAGTTAGAAGCAAGATGG - Intergenic
1188288495 X:28359514-28359536 TCTGGTAGTTAGATCCAATATGG + Intergenic
1189575014 X:42342736-42342758 TCTGGAAGCTTCAGCCCAGAGGG + Intergenic
1190049031 X:47135585-47135607 TCTTGAAGGAAGCCCCAAGAGGG + Intergenic
1190571316 X:51784967-51784989 TCTGAAAGGTAGAAAGAAGAAGG - Intergenic
1190604418 X:52126280-52126302 GCTGGGTGGTAGAGCCAAGACGG + Intergenic
1190607462 X:52159918-52159940 CATGGAGGGTGGAGCCAAGATGG + Intergenic
1191120013 X:56893925-56893947 GATGGCAGGTGGAGCCAAGATGG + Intergenic
1191593552 X:62916426-62916448 TTTGGAAAACAGAGCCAAGAAGG + Intergenic
1191717170 X:64201735-64201757 CCTGGCAGGTAGAACCAAGAGGG - Intronic
1191747311 X:64503215-64503237 TTTAGAAGGAGGAGCCAAGAAGG - Intergenic
1191973994 X:66850120-66850142 TCTGGAAAATAGACCCAAAATGG - Intergenic
1192028905 X:67488330-67488352 TCAGGGGGGTGGAGCCAAGATGG + Intergenic
1192335551 X:70216523-70216545 TCTGCCGGGTGGAGCCAAGATGG - Intergenic
1192352589 X:70369379-70369401 TCTAGGGGGTGGAGCCAAGATGG - Intronic
1192802599 X:74480613-74480635 TCTTGAGGGTGGAGCCAAGATGG - Intronic
1192931497 X:75810919-75810941 CTTGGAGGGTGGAGCCAAGATGG - Intergenic
1192987369 X:76414827-76414849 ACGGGAGGGTGGAGCCAAGATGG + Intergenic
1193051426 X:77103532-77103554 ACTTGGAGGTGGAGCCAAGATGG - Intergenic
1193465284 X:81841150-81841172 TTTGGAGGGAGGAGCCAAGATGG + Intergenic
1194271906 X:91825684-91825706 GCTGGAGGGAGGAGCCAAGATGG - Intronic
1195320884 X:103721227-103721249 TCTGAGAGGTAGAGCCCAGGAGG + Intronic
1195641787 X:107183492-107183514 TCTGAAAGGTAGAGAGAAGAAGG + Intronic
1195832345 X:109072719-109072741 TCTGGGGGGTGGAGCCAAGATGG - Intergenic
1197438309 X:126459939-126459961 CCTGCAAGGTGGAGACAAGATGG + Intergenic
1197657844 X:129136874-129136896 TGTGGAAGCCAGAGTCAAGAGGG + Intergenic
1197927641 X:131663949-131663971 ACTGGGAGGAGGAGCCAAGATGG + Intergenic
1198489239 X:137122415-137122437 ACAGGAGGGTGGAGCCAAGACGG + Intergenic
1198704628 X:139435693-139435715 ACTAGAGGGTGGAGCCAAGATGG + Intergenic
1198818115 X:140614640-140614662 TCTGGGAGCTAGAGCCTAGGAGG + Intergenic
1199292404 X:146119614-146119636 TCTGGAAGCTTCATCCAAGAGGG - Intergenic
1199850914 X:151724548-151724570 TCTGGCCAGGAGAGCCAAGAGGG + Intergenic
1200102919 X:153696975-153696997 TTTTGAAGGTGGAGCCAATAGGG + Intergenic
1200237292 X:154473789-154473811 TCTTGAAGGTAGAGCCACCGGGG - Intergenic
1200589155 Y:5047121-5047143 GCTGGAGGGAGGAGCCAAGATGG - Intronic
1201418927 Y:13776715-13776737 TATGGGAGGAGGAGCCAAGATGG - Intergenic
1201517509 Y:14833862-14833884 ACTGGTAGGTGGAGCCAAGATGG - Intronic
1201651696 Y:16295394-16295416 TCTGGAAGCTACATCCCAGAGGG - Intergenic
1201717993 Y:17066945-17066967 TCTGGGAGGAGGAGCCAAGATGG - Intergenic