ID: 1078558838

View in Genome Browser
Species Human (GRCh38)
Location 11:12353381-12353403
Sequence CCTTTGGATGGCTTCTTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078558833_1078558838 23 Left 1078558833 11:12353335-12353357 CCTTGCTTGTCTCTGTGCTGGTG 0: 1
1: 1
2: 1
3: 36
4: 305
Right 1078558838 11:12353381-12353403 CCTTTGGATGGCTTCTTCCCTGG 0: 1
1: 0
2: 2
3: 16
4: 222
1078558832_1078558838 24 Left 1078558832 11:12353334-12353356 CCCTTGCTTGTCTCTGTGCTGGT 0: 1
1: 0
2: 3
3: 35
4: 347
Right 1078558838 11:12353381-12353403 CCTTTGGATGGCTTCTTCCCTGG 0: 1
1: 0
2: 2
3: 16
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078558838 Original CRISPR CCTTTGGATGGCTTCTTCCC TGG Intronic
900934419 1:5756179-5756201 CCCCGGGATGGCTTCTCCCCTGG - Intergenic
901224744 1:7606784-7606806 CCTTTGGATGGCTCCTGGGCTGG - Intronic
901573267 1:10179319-10179341 CCTTTGGATAGATTTTTCGCTGG + Intronic
903229586 1:21913653-21913675 TCCTAGGATGGCTCCTTCCCTGG - Intronic
905239017 1:36570728-36570750 CCCTTGGAGGGCGTCATCCCAGG - Intergenic
906744938 1:48215034-48215056 CCTCTGGCTGGCTTCCACCCTGG - Intergenic
907663644 1:56415797-56415819 CCTTGGGCTGGTTTCTTCCAGGG - Intergenic
907869710 1:58432164-58432186 CCTTTGCATGGCTGCTTTCTTGG + Intronic
909395970 1:75171087-75171109 CCTTAAGTTGGCTTGTTCCCAGG - Intergenic
910261848 1:85300501-85300523 CCTTTTGGTGGCTTTTTCTCAGG - Intergenic
914331631 1:146676797-146676819 ACTTTGGAGGGCTTCTTCTGCGG + Intergenic
917014295 1:170512039-170512061 CTTTTAGATGGCTTCTAGCCAGG - Intergenic
918136962 1:181682173-181682195 CCTTTGGAGTGCCTCTTGCCTGG + Intronic
918456240 1:184719450-184719472 GCTTTGCTTGCCTTCTTCCCAGG - Exonic
920252625 1:204631899-204631921 CCTTTGGCTGGCCTCTGCCTGGG - Intronic
920546088 1:206819713-206819735 CTTTTGGATAGCTTTTTCCTGGG + Intronic
922316409 1:224446828-224446850 CCTTAGGATGAGTTCTGCCCAGG - Intronic
924461800 1:244266247-244266269 CCTTAAGATGGCTCCATCCCAGG + Intergenic
924940409 1:248809535-248809557 CCTTTGGATGGGTGCTGTCCAGG - Intergenic
1063140421 10:3251714-3251736 GCTGTAGATGCCTTCTTCCCTGG - Intergenic
1064784118 10:18875348-18875370 CCTTTGAATGGCTTCCTCTATGG - Intergenic
1068852408 10:61759123-61759145 ACTGTGGGTGGCTTCATCCCTGG + Intronic
1069563914 10:69450892-69450914 CCTTGGGAAGGGTTCCTCCCGGG - Intergenic
1070944418 10:80377155-80377177 CCTTTGGATAGCGTCTGCCAGGG - Intergenic
1072743279 10:97923040-97923062 CCCTTGGCTGGCTTCCTCACTGG + Intronic
1073480515 10:103783644-103783666 TGCTTGGATGGCTTCCTCCCTGG + Intronic
1074369524 10:112888555-112888577 CCTCTGAATTGCTTCTTCTCAGG - Intergenic
1074382280 10:112991038-112991060 CCTCTGGATCCCTTCTTGCCAGG + Intronic
1075242225 10:120789505-120789527 CCTCTGGTTGGCTTCATCACTGG + Intergenic
1076217222 10:128704836-128704858 CATTTGGATGGCTTCTACTTTGG + Intergenic
1077902726 11:6502776-6502798 CTTTTGGAAGGCCTTTTCCCTGG - Exonic
1078478853 11:11658690-11658712 ACTTGTGATGGCCTCTTCCCTGG + Intergenic
1078558838 11:12353381-12353403 CCTTTGGATGGCTTCTTCCCTGG + Intronic
1078635971 11:13050582-13050604 CCTTTGGATATTTTCTTCCTAGG + Intergenic
1078674957 11:13401995-13402017 CCCTTGAATGTCTTCTTCTCAGG + Intronic
1081513051 11:43795679-43795701 CCTTAGGCTGGCTCCTTTCCTGG - Intronic
1083617169 11:64032038-64032060 CCCTGGGATGGCTTCATGCCTGG + Intronic
1087765460 11:102147642-102147664 CCTGAGGATGGCTTCTACACAGG + Intronic
1089897345 11:121944366-121944388 CTTTTGGATGACTTTTTCTCTGG + Intergenic
1091089909 11:132761976-132761998 CCTTTGGATGGGTTTTTGCGTGG + Intronic
1092667197 12:10815876-10815898 CCCTGGGCTGGCTTCTTCCATGG + Intergenic
1096111849 12:49033600-49033622 CCTTCAGGGGGCTTCTTCCCTGG - Exonic
1096115984 12:49055428-49055450 GGTCTGGATGCCTTCTTCCCAGG - Intronic
1097683555 12:62671306-62671328 CCTTCTAATGGCTCCTTCCCGGG + Intronic
1098970868 12:76855537-76855559 CTTTTGGATGGCTCTTTCCCTGG + Intergenic
1100332593 12:93598519-93598541 CCTCTGGTTGAGTTCTTCCCTGG - Intergenic
1100809526 12:98324867-98324889 CCTCCGGGTGGCTTGTTCCCAGG + Intergenic
1102257810 12:111426246-111426268 TCTGTGGATGGCTCCTACCCAGG + Intronic
1104087620 12:125491047-125491069 CCTTTGGATGACTGCAGCCCTGG + Intronic
1106100151 13:26687547-26687569 CCTTTCCAAGGCTGCTTCCCTGG + Exonic
1106634836 13:31517251-31517273 CCTTCAGATGACTGCTTCCCTGG + Intergenic
1107038678 13:35926507-35926529 ACTGTGGATGGCCTCTTCCTGGG + Intronic
1110407071 13:75162715-75162737 CCTGTGAAGGGCTTCTTTCCAGG - Intergenic
1110625227 13:77647925-77647947 CTCCTGGATGGCTTTTTCCCAGG - Intergenic
1111316710 13:86571672-86571694 CATTTGGGTGGCTCCTTTCCCGG + Intergenic
1111601830 13:90483785-90483807 CTTTTAGATAGCTTCTTCTCAGG - Intergenic
1111769832 13:92583672-92583694 CTTCTGGATAGCTTCTTGCCTGG - Intronic
1118494386 14:66293883-66293905 CCTTTGGATGGTTTCTGCTTTGG - Intergenic
1119922832 14:78462200-78462222 CCTTTGGATGCCTTGATCCATGG + Intronic
1120515481 14:85465068-85465090 CCTGTGGCAGGCTTCTCCCCGGG - Intergenic
1120786098 14:88538409-88538431 CCTTTGGTGAGCTTGTTCCCTGG - Intronic
1121971814 14:98365140-98365162 CCTTTGTATGGCCTCCTGCCAGG - Intergenic
1123998769 15:25737286-25737308 CCAGTGGATGGCTTTTTCCAGGG + Intronic
1124076115 15:26446009-26446031 CCTGTGGATGGCTTCATCTTGGG - Intergenic
1125505578 15:40265866-40265888 CCTGTGGATGGCTACATCTCGGG + Exonic
1128227799 15:66014399-66014421 CCTTAGGGTGGCTCCTTCCTAGG + Intronic
1128979622 15:72176605-72176627 TCCTTGGATGGCTATTTCCCTGG - Intronic
1131783982 15:95891599-95891621 CAGTTGGATGGTTACTTCCCAGG - Intergenic
1131858441 15:96625141-96625163 CCTAAGTATGGCTTCTTCCCAGG + Intergenic
1132194266 15:99898484-99898506 CTTCTGGATAGCTTCTTGCCTGG + Intergenic
1133342220 16:5044239-5044261 CCTCCAGATGCCTTCTTCCCAGG + Exonic
1134870859 16:17651246-17651268 TCCTTGGATGGGTTCTTCCAAGG + Intergenic
1135473293 16:22751427-22751449 CCTAGTGACGGCTTCTTCCCAGG - Intergenic
1136030385 16:27498594-27498616 CCTTGCTATGGGTTCTTCCCGGG + Intronic
1137712412 16:50575511-50575533 CCTTTCCAGGGCTCCTTCCCCGG + Intronic
1138221057 16:55250761-55250783 GCTTTGGATGGCTTCTCCACTGG - Intergenic
1140001923 16:71034103-71034125 ACTTTGGAGGGCTTCTTCTGCGG - Intronic
1140731059 16:77856744-77856766 TCTTTGGATGGCTTTGTCTCAGG - Intronic
1141811517 16:86379275-86379297 CCCTTGGTGGGCTGCTTCCCTGG - Intergenic
1143877647 17:10004228-10004250 CACTTGGATGGCTTCTTGCGGGG - Intronic
1143992129 17:10974820-10974842 CCTGTGGTTGACTTCTTCCTGGG + Intergenic
1145128122 17:20318460-20318482 CCGCTGGATGGCTTGTCCCCTGG - Intronic
1145751114 17:27355692-27355714 CCTCAGGATGACTGCTTCCCAGG - Intergenic
1149166625 17:53759935-53759957 CTTTTGGTGGGCTTCATCCCTGG + Intergenic
1150119418 17:62587486-62587508 CCTTTAGTTGGCTTCTAGCCTGG + Intronic
1150660554 17:67072470-67072492 CATTCTGATGGCTTCTTTCCAGG + Exonic
1152353912 17:79797714-79797736 CCATCGGCTGGCTTCTCCCCCGG + Intronic
1153846692 18:9056521-9056543 CATTTGGATAGCTGCTTCTCTGG - Intergenic
1157593717 18:48851232-48851254 CCTTCCCATGCCTTCTTCCCTGG - Intronic
1158188463 18:54798202-54798224 ACGGTGGATGGCTGCTTCCCAGG - Intronic
1158415945 18:57249905-57249927 TCTTTGGATGGCATTGTCCCTGG - Intergenic
1158876039 18:61735504-61735526 CCATTGGAGGGCTTGTTCCCGGG - Intergenic
1162522693 19:11191359-11191381 CATTTGGGTGGCTTCTCCCAGGG + Intronic
1163096116 19:15058372-15058394 CCAGTGGCTGGCTTCCTCCCAGG + Intergenic
1164447941 19:28333664-28333686 CCTTAGGCTGGCTTCCTCCTAGG - Intergenic
1165230610 19:34384211-34384233 CCTTTGTCTGGTCTCTTCCCAGG - Intronic
1165713461 19:38028398-38028420 CCTCTGGAAGGCTCTTTCCCAGG + Intronic
1167918949 19:52765753-52765775 CATTTGTATGGTTTCTTTCCAGG + Exonic
925313435 2:2904428-2904450 GCCTTGGCTTGCTTCTTCCCTGG - Intergenic
925915218 2:8600016-8600038 CCTTTGGGTGGCATCTCCCTGGG - Intergenic
926977856 2:18532905-18532927 CCCTTGTATTGCTTCTTCCTTGG + Intergenic
926995259 2:18728360-18728382 CATTTGCATGGCAACTTCCCAGG - Intergenic
927228874 2:20800040-20800062 CCTTTGGATGGCTTATTACATGG - Intronic
927484735 2:23480731-23480753 CTTTTGGATGGCTTGATCCAGGG - Intronic
931835965 2:66098529-66098551 GGTTTTGATGGCTTCTTCCAGGG - Intergenic
932679778 2:73815084-73815106 CCTGGGGATGGATACTTCCCTGG + Exonic
934053825 2:88234953-88234975 CCTCTGGATTGCAACTTCCCAGG - Intergenic
935044776 2:99470933-99470955 TCTTTGGAATGCTTGTTCCCTGG - Intronic
935337786 2:102033417-102033439 CGTCTGGATGGCTTCTCCACTGG - Intergenic
936345381 2:111671725-111671747 CCACTGGAAGGCTTCTGCCCTGG + Intergenic
937069944 2:119055621-119055643 CCTTTGGATGACTTCAACCTGGG - Intergenic
937577284 2:123438893-123438915 CCTCTGGATGGCTATTTCCCAGG + Intergenic
939892509 2:147754251-147754273 CCTTTGCGTGGCTCCTTTCCCGG - Intergenic
941342418 2:164323933-164323955 ACTCTGAATTGCTTCTTCCCTGG - Intergenic
941646615 2:168047759-168047781 GCATTGGAGGGCTTCTGCCCTGG - Intronic
942001676 2:171654067-171654089 CCTTTGGGTGGTCTCCTCCCAGG + Intergenic
942292436 2:174486507-174486529 CCTTCCGAAGGCTTCTGCCCAGG - Intronic
942779313 2:179622527-179622549 GCTTGGGAGGGCATCTTCCCAGG + Intronic
944478430 2:200130116-200130138 GCTTAGGATGGCTCCTCCCCAGG + Intergenic
946095395 2:217270204-217270226 CCTTTGGCTGCCTCCTGCCCTGG + Intergenic
946432173 2:219631730-219631752 CCTTTGGATTGCATCTTGGCCGG + Intronic
947158167 2:227184867-227184889 CCTTTGCATGGCTGCCTCACTGG + Intronic
948284506 2:236773337-236773359 CCCTGGGATGGCTCCTGCCCTGG + Intergenic
948923981 2:241082160-241082182 CCTTAGGCTGGCTTCCTCCAAGG - Intronic
1168766976 20:388343-388365 CCTTTGGAGGCCTCCTTCCCAGG - Intronic
1168953356 20:1817582-1817604 CCTGTGGATTTCTTCTTCCAAGG + Intergenic
1169730102 20:8777311-8777333 CTTTGGGACGGCTTCTTCCTAGG - Intronic
1170272518 20:14543985-14544007 TATTTGGCTGGCTTCTTCCTGGG + Intronic
1172227618 20:33315703-33315725 CCTCTGGGTGGCTTCTTCATGGG + Intergenic
1173653761 20:44684724-44684746 CATTTGGATATCTTCTTCCAGGG - Intergenic
1174195094 20:48767290-48767312 TCTTTCAATGGCTCCTTCCCTGG + Intronic
1175334801 20:58188360-58188382 CCTTTGTATGGCCCTTTCCCTGG + Intergenic
1175903263 20:62368191-62368213 CCTTTGGGTGGCTGCGGCCCTGG + Intergenic
1177159687 21:17534525-17534547 CCTTTGCCTTTCTTCTTCCCAGG - Intronic
1178299315 21:31438688-31438710 CCTTTGGAGGGTTTCTTAACAGG - Intronic
1178706346 21:34876580-34876602 CCTTTGGAAGGCTTTTTCCAAGG - Intronic
1178978845 21:37244131-37244153 CCTTTGGAATGCTTGTTTCCAGG - Intronic
1179281962 21:39941377-39941399 CCTTGGGATAGCTGCTTCCCAGG + Intergenic
1181138664 22:20787524-20787546 TCTTGAGGTGGCTTCTTCCCTGG - Exonic
1181443182 22:22949173-22949195 CCTTTGGATGGCTTCATGTATGG - Intergenic
1182131683 22:27857731-27857753 CCTCGGGATGGATTCTTCCCTGG - Intronic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
949324062 3:2843904-2843926 CCTTTGGAGGGCTTTTGGCCAGG - Intronic
951051113 3:18094952-18094974 CTTTGGGATTGCTTGTTCCCTGG + Intronic
951133369 3:19075044-19075066 CCTGTGGCAGGCTTCTTCCTGGG - Intergenic
951427129 3:22560437-22560459 CCTTAGGCTAGCTTCTTCTCGGG + Intergenic
952714135 3:36461719-36461741 CACTTGGAATGCTTCTTCCCAGG - Intronic
952830090 3:37557443-37557465 CCTATGGATGGCTGCTTCGAAGG - Intronic
952953769 3:38544069-38544091 CCCTTGGGTGGGGTCTTCCCTGG - Intergenic
953698772 3:45180170-45180192 CCTTTAGATGACTGCATCCCTGG - Intergenic
955615267 3:60800697-60800719 TCTTTCCGTGGCTTCTTCCCTGG - Intronic
955823723 3:62923239-62923261 TCTTTGGAGGGTTTGTTCCCAGG - Intergenic
956464943 3:69510641-69510663 CCTTTGGCTTGCTTGTTGCCTGG - Intronic
958448322 3:94242137-94242159 CCTTTTGAAGGCCCCTTCCCAGG - Intergenic
961781080 3:129320336-129320358 CCCATGGCTGGCTCCTTCCCTGG + Intergenic
961902896 3:130231600-130231622 GCTTTGGATGCCTCCTTTCCAGG + Intergenic
965488661 3:169309977-169309999 CATTTAAATGGCCTCTTCCCCGG - Intronic
966554374 3:181242689-181242711 CATGTGGATGGCTACTTCCAGGG + Intergenic
969354894 4:6619564-6619586 ACTGTGGCTGGCTTCCTCCCTGG + Intronic
970058259 4:12000059-12000081 CCTGTGGAAGGCTTCTTCCTGGG + Intergenic
970367773 4:15377664-15377686 CCTTTCCATGACCTCTTCCCAGG - Intronic
971342365 4:25782261-25782283 CATTTGGATGGCATCTTCCCTGG - Exonic
973628209 4:52793486-52793508 CCTTTGGATGACTGCAGCCCCGG + Intergenic
975118789 4:70705940-70705962 GCTTTGGAAGGCTACCTCCCAGG + Intronic
975512758 4:75211596-75211618 GCATTGGATGCCTTTTTCCCAGG + Intergenic
979494718 4:121370476-121370498 CCTCTGGATGGACTCTTCCTGGG - Intronic
982216435 4:153086445-153086467 CTTATGGATGCCTTCCTCCCAGG + Intergenic
982383688 4:154777273-154777295 TCCATGGATGGCATCTTCCCTGG - Intergenic
987634901 5:20526732-20526754 CCTTTGGATGGCATTTTCGTGGG - Intronic
989265898 5:39473525-39473547 CCATGGGATGCCTTCTCCCCAGG - Intergenic
991944306 5:71884623-71884645 CCTTTTCAAGGCTCCTTCCCTGG - Intergenic
994015145 5:94956238-94956260 CCTTTGGATGGAGTTTTCCACGG - Intronic
994677929 5:102848406-102848428 CAGATGGATGGATTCTTCCCTGG + Intronic
996495993 5:124157285-124157307 CCTGTGGATGGATTTTTACCTGG + Intergenic
996523129 5:124449267-124449289 CCATAGGAAGGCTTCTTCACTGG - Intergenic
999816807 5:155184950-155184972 CCTGTGGATGCCCTCCTCCCAGG + Intergenic
1002020253 5:176359894-176359916 CCTCTGGATGGACTCTTCCTGGG - Exonic
1004975247 6:20958187-20958209 CTTTTGGATGGCTTTCTCCCTGG - Intronic
1005738557 6:28770960-28770982 TCGTAGGATGGCTTCTTTCCGGG + Intergenic
1005835895 6:29709378-29709400 CCTGTGGCTGGCGTCTTCCTTGG + Intergenic
1006456205 6:34133403-34133425 CCCCTGGATGCCTTCCTCCCTGG - Exonic
1007387836 6:41531428-41531450 ACTTTTAATGGCTGCTTCCCAGG - Intergenic
1008733972 6:54519659-54519681 CCTTTGGATGGGGTATACCCAGG + Intergenic
1008847221 6:55982424-55982446 CCTTTTCAAGACTTCTTCCCTGG + Intergenic
1016420959 6:143882672-143882694 TCTTTCCATGACTTCTTCCCTGG + Intronic
1017936535 6:159010420-159010442 CCAGTGGATGGCTTGATCCCAGG - Intergenic
1018409800 6:163532700-163532722 CTTTTGGGTGGTTCCTTCCCTGG + Intronic
1018470751 6:164095889-164095911 TCTTTGGATGCCTTCTTCCCTGG - Intergenic
1019002240 6:168763898-168763920 CCTATGGCAGGCTTCTGCCCAGG + Intergenic
1019369713 7:655287-655309 CCTGTCAATGGCCTCTTCCCAGG + Intronic
1020786557 7:12580617-12580639 CTTTTGGGTGCCTTCTTCTCTGG + Intronic
1021589256 7:22242576-22242598 CTTTTGGATCGCTCATTCCCTGG - Intronic
1022422618 7:30238166-30238188 CCTTTGGATGACTGCAGCCCTGG + Intergenic
1022768830 7:33447058-33447080 CCTTTGGATGGATGCTTCTAAGG - Intronic
1023856165 7:44185622-44185644 CCTTTGGCTTGCTCCTGCCCTGG + Intronic
1024555874 7:50603283-50603305 ACTGTGGCTGGCTCCTTCCCAGG + Intronic
1028483571 7:91334307-91334329 TATTTGGGTGGCCTCTTCCCAGG + Intergenic
1030523488 7:110627099-110627121 CATTTGGATAGCATCTTCCTGGG - Intergenic
1030640764 7:112003643-112003665 CCTCTGGAGGGCTCCTGCCCAGG - Intronic
1030680489 7:112428686-112428708 CCTTTGAATGGCTTCATGCAAGG - Intronic
1031556721 7:123185935-123185957 CCTATTGATGGGTTCATCCCAGG + Intronic
1032792066 7:135249777-135249799 TCTTTGGATGTGTTCTTCCTGGG - Intronic
1032819113 7:135508874-135508896 TCTTTGGATTGCCTCTCCCCAGG - Intronic
1033720039 7:144049579-144049601 CCTTTGCAGGGCTGCTTCCCTGG - Intergenic
1035732636 8:1863628-1863650 ACTCTGGCTGGCTTCTGCCCAGG + Intronic
1038051612 8:23819234-23819256 CTTTTGGATGGTTCTTTCCCTGG + Intergenic
1038739716 8:30206618-30206640 CCTCTGGCTGGCTTTTTCCAAGG - Intergenic
1039167629 8:34702581-34702603 CCTTTGGGATGGTTCTTCCCCGG + Intergenic
1039967236 8:42292326-42292348 ACTTTCGATCTCTTCTTCCCTGG - Intronic
1041403298 8:57467781-57467803 CCATTGCATAGCTTCTTCTCAGG - Intergenic
1042839743 8:73111674-73111696 CAGTTGGCTGGCTTCTTTCCAGG - Intronic
1045190701 8:99880071-99880093 CCTGGGGATGCCATCTTCCCTGG - Intronic
1045365353 8:101470660-101470682 CCATTGGATGCCTTCTCCCTGGG + Intergenic
1046870743 8:119203632-119203654 CCTTTGGAATGTTTCTGCCCTGG + Intronic
1047027054 8:120835599-120835621 CCTTCCGTTGTCTTCTTCCCTGG + Intergenic
1048488157 8:134867541-134867563 ACTTGGGATGGCTGTTTCCCAGG + Intergenic
1048516174 8:135113703-135113725 CCTTTGGAAGTCTTCTGCCTGGG - Intergenic
1048846802 8:138609914-138609936 CCCTTGGATCTCTGCTTCCCAGG + Intronic
1050246249 9:3693354-3693376 CCTTTGGATGCCATCTTCTAAGG - Intergenic
1053459353 9:38256679-38256701 ACTTTGGCTGCCTTCTTTCCAGG + Intergenic
1053487624 9:38471754-38471776 CCTTGGGAGGGCTGATTCCCGGG - Intergenic
1055685294 9:78766871-78766893 CCTTGGGATGCCCTCTTCCCAGG + Intergenic
1056312351 9:85353131-85353153 CCTGTGGAAGGCTTCTGCCTGGG + Intergenic
1057964309 9:99488360-99488382 CCTGTGGCTGCCTCCTTCCCTGG - Intergenic
1059978008 9:119738386-119738408 CCTCTGGATGGCAGCTTCGCTGG + Intergenic
1061054068 9:128212723-128212745 CCTTTGGATCGATTCTTGCATGG - Intronic
1061550033 9:131329057-131329079 CCTTTGGTTGGCCACTGCCCTGG + Intergenic
1186837940 X:13456764-13456786 ACTTTGGATGTCTTTGTCCCAGG - Intergenic
1188238243 X:27754551-27754573 TCTGTGGAAGGCTTCTTCCTGGG + Intergenic
1188408161 X:29838077-29838099 CTTTAGGAACGCTTCTTCCCTGG - Intronic
1190438273 X:50449307-50449329 CCTTTGGGTGGATCTTTCCCAGG - Intronic
1190756187 X:53404057-53404079 CCATCACATGGCTTCTTCCCTGG + Intronic
1192913040 X:75625260-75625282 CCTTTGTATAGATTCTTCCCTGG - Intergenic
1194368705 X:93043110-93043132 CCTTTGGATAGCTTGAGCCCAGG - Intergenic
1196900505 X:120378369-120378391 CCTTTGGATTGCTTCTGTCTGGG + Intronic
1198097340 X:133392865-133392887 CCGTTGGATGATTTCTTTCCAGG + Intronic
1199602280 X:149548722-149548744 CATTTTGATTGCTTCTTTCCTGG + Intronic
1199648107 X:149930753-149930775 CATTTTGATTGCTTCTTTCCTGG - Intronic
1199876157 X:151929952-151929974 ACTGTGGATGCCTCCTTCCCAGG - Intergenic
1200204373 X:154305180-154305202 CCCTTGGTTGGATTCTTCCCGGG + Intronic
1200676908 Y:6159439-6159461 CCTTTGGATAGCTTGAGCCCAGG - Intergenic