ID: 1078560198

View in Genome Browser
Species Human (GRCh38)
Location 11:12364533-12364555
Sequence CTAGAGTCTCAGAGGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078560198_1078560205 11 Left 1078560198 11:12364533-12364555 CCATGTTCCCTCTGAGACTCTAG No data
Right 1078560205 11:12364567-12364589 TTGTCGCCTCCTCCACCTTCTGG No data
1078560198_1078560208 21 Left 1078560198 11:12364533-12364555 CCATGTTCCCTCTGAGACTCTAG No data
Right 1078560208 11:12364577-12364599 CTCCACCTTCTGGAAGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078560198 Original CRISPR CTAGAGTCTCAGAGGGAACA TGG (reversed) Intergenic
No off target data available for this crispr