ID: 1078560919

View in Genome Browser
Species Human (GRCh38)
Location 11:12371719-12371741
Sequence GAAAATGCACATATACACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078560912_1078560919 26 Left 1078560912 11:12371670-12371692 CCAAGACTTGGAACCAACCCAAA 0: 44
1: 31
2: 52
3: 569
4: 3271
Right 1078560919 11:12371719-12371741 GAAAATGCACATATACACCATGG No data
1078560915_1078560919 8 Left 1078560915 11:12371688-12371710 CCAAATGCCCATCAATGATAGAC 0: 3436
1: 8136
2: 17307
3: 6407
4: 3019
Right 1078560919 11:12371719-12371741 GAAAATGCACATATACACCATGG No data
1078560917_1078560919 1 Left 1078560917 11:12371695-12371717 CCCATCAATGATAGACTGGATTA 0: 325
1: 4293
2: 5651
3: 4398
4: 3647
Right 1078560919 11:12371719-12371741 GAAAATGCACATATACACCATGG No data
1078560918_1078560919 0 Left 1078560918 11:12371696-12371718 CCATCAATGATAGACTGGATTAA 0: 3914
1: 19487
2: 11603
3: 6325
4: 4628
Right 1078560919 11:12371719-12371741 GAAAATGCACATATACACCATGG No data
1078560913_1078560919 13 Left 1078560913 11:12371683-12371705 CCAACCCAAATGCCCATCAATGA 0: 2966
1: 7716
2: 16966
3: 7589
4: 3190
Right 1078560919 11:12371719-12371741 GAAAATGCACATATACACCATGG No data
1078560914_1078560919 9 Left 1078560914 11:12371687-12371709 CCCAAATGCCCATCAATGATAGA 0: 4049
1: 9530
2: 18393
3: 8790
4: 5630
Right 1078560919 11:12371719-12371741 GAAAATGCACATATACACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078560919 Original CRISPR GAAAATGCACATATACACCA TGG Intergenic
No off target data available for this crispr